ID: 1160067283

View in Genome Browser
Species Human (GRCh38)
Location 18:75587453-75587475
Sequence CTGGTGAACTTGGGCACAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160067283_1160067291 14 Left 1160067283 18:75587453-75587475 CCAGTTGTGCCCAAGTTCACCAG No data
Right 1160067291 18:75587490-75587512 CGCCCACTGGTCTCTATATTTGG No data
1160067283_1160067289 1 Left 1160067283 18:75587453-75587475 CCAGTTGTGCCCAAGTTCACCAG No data
Right 1160067289 18:75587477-75587499 CTCCATTTGGCATCGCCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160067283 Original CRISPR CTGGTGAACTTGGGCACAAC TGG (reversed) Intergenic
No off target data available for this crispr