ID: 1160072777

View in Genome Browser
Species Human (GRCh38)
Location 18:75643038-75643060
Sequence CAGAAGCCACGTGGGTAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160072768_1160072777 -5 Left 1160072768 18:75643020-75643042 CCCAGGGAGGAGGGTCCCCAGAA No data
Right 1160072777 18:75643038-75643060 CAGAAGCCACGTGGGTAGAGGGG No data
1160072769_1160072777 -6 Left 1160072769 18:75643021-75643043 CCAGGGAGGAGGGTCCCCAGAAG No data
Right 1160072777 18:75643038-75643060 CAGAAGCCACGTGGGTAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160072777 Original CRISPR CAGAAGCCACGTGGGTAGAG GGG Intergenic
No off target data available for this crispr