ID: 1160073254

View in Genome Browser
Species Human (GRCh38)
Location 18:75647194-75647216
Sequence GCAGGAAGGCTCTAAGAAAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160073247_1160073254 17 Left 1160073247 18:75647154-75647176 CCCTAGGTGAGCATCAACAGGAG No data
Right 1160073254 18:75647194-75647216 GCAGGAAGGCTCTAAGAAACCGG No data
1160073246_1160073254 18 Left 1160073246 18:75647153-75647175 CCCCTAGGTGAGCATCAACAGGA No data
Right 1160073254 18:75647194-75647216 GCAGGAAGGCTCTAAGAAACCGG No data
1160073248_1160073254 16 Left 1160073248 18:75647155-75647177 CCTAGGTGAGCATCAACAGGAGT No data
Right 1160073254 18:75647194-75647216 GCAGGAAGGCTCTAAGAAACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160073254 Original CRISPR GCAGGAAGGCTCTAAGAAAC CGG Intergenic