ID: 1160087375

View in Genome Browser
Species Human (GRCh38)
Location 18:75789330-75789352
Sequence TGCAGCTCCACTAGACTAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160087375_1160087381 16 Left 1160087375 18:75789330-75789352 CCAGTTAGTCTAGTGGAGCTGCA No data
Right 1160087381 18:75789369-75789391 GGTGCAGAAAGTTCCAGGTTGGG No data
1160087375_1160087379 11 Left 1160087375 18:75789330-75789352 CCAGTTAGTCTAGTGGAGCTGCA No data
Right 1160087379 18:75789364-75789386 GAGAGGGTGCAGAAAGTTCCAGG No data
1160087375_1160087382 24 Left 1160087375 18:75789330-75789352 CCAGTTAGTCTAGTGGAGCTGCA No data
Right 1160087382 18:75789377-75789399 AAGTTCCAGGTTGGGACCACTGG No data
1160087375_1160087380 15 Left 1160087375 18:75789330-75789352 CCAGTTAGTCTAGTGGAGCTGCA No data
Right 1160087380 18:75789368-75789390 GGGTGCAGAAAGTTCCAGGTTGG No data
1160087375_1160087383 25 Left 1160087375 18:75789330-75789352 CCAGTTAGTCTAGTGGAGCTGCA No data
Right 1160087383 18:75789378-75789400 AGTTCCAGGTTGGGACCACTGGG No data
1160087375_1160087376 -6 Left 1160087375 18:75789330-75789352 CCAGTTAGTCTAGTGGAGCTGCA No data
Right 1160087376 18:75789347-75789369 GCTGCAAGAAATCCTATGAGAGG No data
1160087375_1160087377 -5 Left 1160087375 18:75789330-75789352 CCAGTTAGTCTAGTGGAGCTGCA No data
Right 1160087377 18:75789348-75789370 CTGCAAGAAATCCTATGAGAGGG No data
1160087375_1160087385 30 Left 1160087375 18:75789330-75789352 CCAGTTAGTCTAGTGGAGCTGCA No data
Right 1160087385 18:75789383-75789405 CAGGTTGGGACCACTGGGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160087375 Original CRISPR TGCAGCTCCACTAGACTAAC TGG (reversed) Intergenic
No off target data available for this crispr