ID: 1160087377

View in Genome Browser
Species Human (GRCh38)
Location 18:75789348-75789370
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160087372_1160087377 4 Left 1160087372 18:75789321-75789343 CCCAATGTTCCAGTTAGTCTAGT No data
Right 1160087377 18:75789348-75789370 CTGCAAGAAATCCTATGAGAGGG No data
1160087373_1160087377 3 Left 1160087373 18:75789322-75789344 CCAATGTTCCAGTTAGTCTAGTG No data
Right 1160087377 18:75789348-75789370 CTGCAAGAAATCCTATGAGAGGG No data
1160087371_1160087377 12 Left 1160087371 18:75789313-75789335 CCACATTTCCCAATGTTCCAGTT No data
Right 1160087377 18:75789348-75789370 CTGCAAGAAATCCTATGAGAGGG No data
1160087375_1160087377 -5 Left 1160087375 18:75789330-75789352 CCAGTTAGTCTAGTGGAGCTGCA No data
Right 1160087377 18:75789348-75789370 CTGCAAGAAATCCTATGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160087377 Original CRISPR CTGCAAGAAATCCTATGAGA GGG Intergenic
No off target data available for this crispr