ID: 1160088371

View in Genome Browser
Species Human (GRCh38)
Location 18:75801468-75801490
Sequence CCCTGGAGGGCCATGTGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160088371_1160088378 9 Left 1160088371 18:75801468-75801490 CCTCATCACATGGCCCTCCAGGG No data
Right 1160088378 18:75801500-75801522 TCCCAGTTCATGTTAATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160088371 Original CRISPR CCCTGGAGGGCCATGTGATG AGG (reversed) Intergenic
No off target data available for this crispr