ID: 1160090142

View in Genome Browser
Species Human (GRCh38)
Location 18:75819153-75819175
Sequence ATCTTTGTTTACTGCACACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160090142_1160090150 29 Left 1160090142 18:75819153-75819175 CCAAGTGTGCAGTAAACAAAGAT No data
Right 1160090150 18:75819205-75819227 ATGGAGAGGAAGAATGAACATGG No data
1160090142_1160090147 15 Left 1160090142 18:75819153-75819175 CCAAGTGTGCAGTAAACAAAGAT No data
Right 1160090147 18:75819191-75819213 CTCTCCCTGATGTGATGGAGAGG No data
1160090142_1160090145 10 Left 1160090142 18:75819153-75819175 CCAAGTGTGCAGTAAACAAAGAT No data
Right 1160090145 18:75819186-75819208 CACCTCTCTCCCTGATGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160090142 Original CRISPR ATCTTTGTTTACTGCACACT TGG (reversed) Intergenic
No off target data available for this crispr