ID: 1160090146

View in Genome Browser
Species Human (GRCh38)
Location 18:75819188-75819210
Sequence CTCCATCACATCAGGGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160090146_1160090150 -6 Left 1160090146 18:75819188-75819210 CCTCTCTCCCTGATGTGATGGAG No data
Right 1160090150 18:75819205-75819227 ATGGAGAGGAAGAATGAACATGG No data
1160090146_1160090151 7 Left 1160090146 18:75819188-75819210 CCTCTCTCCCTGATGTGATGGAG No data
Right 1160090151 18:75819218-75819240 ATGAACATGGTAACTTTTCATGG No data
1160090146_1160090154 30 Left 1160090146 18:75819188-75819210 CCTCTCTCCCTGATGTGATGGAG No data
Right 1160090154 18:75819241-75819263 CCCTTGAATTTTTGGAAAGTAGG No data
1160090146_1160090152 22 Left 1160090146 18:75819188-75819210 CCTCTCTCCCTGATGTGATGGAG No data
Right 1160090152 18:75819233-75819255 TTTCATGGCCCTTGAATTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160090146 Original CRISPR CTCCATCACATCAGGGAGAG AGG (reversed) Intergenic
No off target data available for this crispr