ID: 1160095562

View in Genome Browser
Species Human (GRCh38)
Location 18:75869221-75869243
Sequence TGAGATCTTAATAGACATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160095562_1160095565 -10 Left 1160095562 18:75869221-75869243 CCATCATGTCTATTAAGATCTCA No data
Right 1160095565 18:75869234-75869256 TAAGATCTCAGTGGTAATATGGG No data
1160095562_1160095566 -2 Left 1160095562 18:75869221-75869243 CCATCATGTCTATTAAGATCTCA No data
Right 1160095566 18:75869242-75869264 CAGTGGTAATATGGGAGCATTGG No data
1160095562_1160095567 22 Left 1160095562 18:75869221-75869243 CCATCATGTCTATTAAGATCTCA No data
Right 1160095567 18:75869266-75869288 ATTTAATAGAAACAGATTCTAGG No data
1160095562_1160095568 27 Left 1160095562 18:75869221-75869243 CCATCATGTCTATTAAGATCTCA No data
Right 1160095568 18:75869271-75869293 ATAGAAACAGATTCTAGGTCAGG No data
1160095562_1160095569 30 Left 1160095562 18:75869221-75869243 CCATCATGTCTATTAAGATCTCA No data
Right 1160095569 18:75869274-75869296 GAAACAGATTCTAGGTCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160095562 Original CRISPR TGAGATCTTAATAGACATGA TGG (reversed) Intergenic
No off target data available for this crispr