ID: 1160095836

View in Genome Browser
Species Human (GRCh38)
Location 18:75872081-75872103
Sequence CGCAGATATCAGGCAGGCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160095836_1160095845 15 Left 1160095836 18:75872081-75872103 CCGCAGCCTGCCTGATATCTGCG No data
Right 1160095845 18:75872119-75872141 TACAAATATGGCCGTAAGTGCGG No data
1160095836_1160095842 -9 Left 1160095836 18:75872081-75872103 CCGCAGCCTGCCTGATATCTGCG No data
Right 1160095842 18:75872095-75872117 ATATCTGCGCCTTTTGGGGTTGG No data
1160095836_1160095846 18 Left 1160095836 18:75872081-75872103 CCGCAGCCTGCCTGATATCTGCG No data
Right 1160095846 18:75872122-75872144 AAATATGGCCGTAAGTGCGGTGG No data
1160095836_1160095844 3 Left 1160095836 18:75872081-75872103 CCGCAGCCTGCCTGATATCTGCG No data
Right 1160095844 18:75872107-75872129 TTTGGGGTTGGCTACAAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160095836 Original CRISPR CGCAGATATCAGGCAGGCTG CGG (reversed) Intergenic
No off target data available for this crispr