ID: 1160099326

View in Genome Browser
Species Human (GRCh38)
Location 18:75905337-75905359
Sequence TTGAGGATACACAGGCATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160099318_1160099326 14 Left 1160099318 18:75905300-75905322 CCTCACCTGATGCAGCTTTTGAA No data
Right 1160099326 18:75905337-75905359 TTGAGGATACACAGGCATGGAGG No data
1160099320_1160099326 9 Left 1160099320 18:75905305-75905327 CCTGATGCAGCTTTTGAAGGAGA No data
Right 1160099326 18:75905337-75905359 TTGAGGATACACAGGCATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160099326 Original CRISPR TTGAGGATACACAGGCATGG AGG Intergenic
No off target data available for this crispr