ID: 1160100440

View in Genome Browser
Species Human (GRCh38)
Location 18:75915961-75915983
Sequence CAGAGGAGCGGGCCTGGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160100440_1160100458 18 Left 1160100440 18:75915961-75915983 CCCGGCCCAGGCCCGCTCCTCTG No data
Right 1160100458 18:75916002-75916024 GGCCGTCAGGAGGGGAGGCCTGG No data
1160100440_1160100452 10 Left 1160100440 18:75915961-75915983 CCCGGCCCAGGCCCGCTCCTCTG No data
Right 1160100452 18:75915994-75916016 GCCCCCGCGGCCGTCAGGAGGGG No data
1160100440_1160100450 8 Left 1160100440 18:75915961-75915983 CCCGGCCCAGGCCCGCTCCTCTG No data
Right 1160100450 18:75915992-75916014 TGGCCCCCGCGGCCGTCAGGAGG No data
1160100440_1160100448 -3 Left 1160100440 18:75915961-75915983 CCCGGCCCAGGCCCGCTCCTCTG No data
Right 1160100448 18:75915981-75916003 CTGCGCAGCGCTGGCCCCCGCGG No data
1160100440_1160100456 13 Left 1160100440 18:75915961-75915983 CCCGGCCCAGGCCCGCTCCTCTG No data
Right 1160100456 18:75915997-75916019 CCCGCGGCCGTCAGGAGGGGAGG No data
1160100440_1160100451 9 Left 1160100440 18:75915961-75915983 CCCGGCCCAGGCCCGCTCCTCTG No data
Right 1160100451 18:75915993-75916015 GGCCCCCGCGGCCGTCAGGAGGG No data
1160100440_1160100449 5 Left 1160100440 18:75915961-75915983 CCCGGCCCAGGCCCGCTCCTCTG No data
Right 1160100449 18:75915989-75916011 CGCTGGCCCCCGCGGCCGTCAGG No data
1160100440_1160100460 28 Left 1160100440 18:75915961-75915983 CCCGGCCCAGGCCCGCTCCTCTG No data
Right 1160100460 18:75916012-75916034 AGGGGAGGCCTGGAGACCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160100440 Original CRISPR CAGAGGAGCGGGCCTGGGCC GGG (reversed) Intergenic
No off target data available for this crispr