ID: 1160102769

View in Genome Browser
Species Human (GRCh38)
Location 18:75938543-75938565
Sequence CGGCAAACAGCAATGGTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160102762_1160102769 24 Left 1160102762 18:75938496-75938518 CCCTGTTGGATCTGGAGGGACAG No data
Right 1160102769 18:75938543-75938565 CGGCAAACAGCAATGGTGGACGG No data
1160102763_1160102769 23 Left 1160102763 18:75938497-75938519 CCTGTTGGATCTGGAGGGACAGA No data
Right 1160102769 18:75938543-75938565 CGGCAAACAGCAATGGTGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160102769 Original CRISPR CGGCAAACAGCAATGGTGGA CGG Intergenic
No off target data available for this crispr