ID: 1160105490

View in Genome Browser
Species Human (GRCh38)
Location 18:75970569-75970591
Sequence GGATCATGGTGTCCTGCCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160105480_1160105490 14 Left 1160105480 18:75970532-75970554 CCTGCGCACCAGCAGAGCCCTCT No data
Right 1160105490 18:75970569-75970591 GGATCATGGTGTCCTGCCACCGG No data
1160105484_1160105490 -4 Left 1160105484 18:75970550-75970572 CCTCTCCAAATCCACCCGTGGAT No data
Right 1160105490 18:75970569-75970591 GGATCATGGTGTCCTGCCACCGG No data
1160105478_1160105490 18 Left 1160105478 18:75970528-75970550 CCCTCCTGCGCACCAGCAGAGCC No data
Right 1160105490 18:75970569-75970591 GGATCATGGTGTCCTGCCACCGG No data
1160105485_1160105490 -9 Left 1160105485 18:75970555-75970577 CCAAATCCACCCGTGGATCATGG No data
Right 1160105490 18:75970569-75970591 GGATCATGGTGTCCTGCCACCGG No data
1160105483_1160105490 -3 Left 1160105483 18:75970549-75970571 CCCTCTCCAAATCCACCCGTGGA No data
Right 1160105490 18:75970569-75970591 GGATCATGGTGTCCTGCCACCGG No data
1160105479_1160105490 17 Left 1160105479 18:75970529-75970551 CCTCCTGCGCACCAGCAGAGCCC No data
Right 1160105490 18:75970569-75970591 GGATCATGGTGTCCTGCCACCGG No data
1160105481_1160105490 6 Left 1160105481 18:75970540-75970562 CCAGCAGAGCCCTCTCCAAATCC No data
Right 1160105490 18:75970569-75970591 GGATCATGGTGTCCTGCCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160105490 Original CRISPR GGATCATGGTGTCCTGCCAC CGG Intergenic
No off target data available for this crispr