ID: 1160106903

View in Genome Browser
Species Human (GRCh38)
Location 18:75986926-75986948
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160106903_1160106913 27 Left 1160106903 18:75986926-75986948 CCACTTGGAAATGAACTTGGGCC No data
Right 1160106913 18:75986976-75986998 TCTGTGAGTCCCCATTTCACAGG No data
1160106903_1160106914 28 Left 1160106903 18:75986926-75986948 CCACTTGGAAATGAACTTGGGCC No data
Right 1160106914 18:75986977-75986999 CTGTGAGTCCCCATTTCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160106903 Original CRISPR GGCCCAAGTTCATTTCCAAG TGG (reversed) Intergenic