ID: 1160106903 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 18:75986926-75986948 |
| Sequence | GGCCCAAGTTCATTTCCAAG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1160106903_1160106914 | 28 | Left | 1160106903 | 18:75986926-75986948 | CCACTTGGAAATGAACTTGGGCC | No data | ||
| Right | 1160106914 | 18:75986977-75986999 | CTGTGAGTCCCCATTTCACAGGG | No data | ||||
| 1160106903_1160106913 | 27 | Left | 1160106903 | 18:75986926-75986948 | CCACTTGGAAATGAACTTGGGCC | No data | ||
| Right | 1160106913 | 18:75986976-75986998 | TCTGTGAGTCCCCATTTCACAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1160106903 | Original CRISPR | GGCCCAAGTTCATTTCCAAG TGG (reversed) | Intergenic | ||