ID: 1160106903 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 18:75986926-75986948 |
Sequence | GGCCCAAGTTCATTTCCAAG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1160106903_1160106913 | 27 | Left | 1160106903 | 18:75986926-75986948 | CCACTTGGAAATGAACTTGGGCC | No data | ||
Right | 1160106913 | 18:75986976-75986998 | TCTGTGAGTCCCCATTTCACAGG | No data | ||||
1160106903_1160106914 | 28 | Left | 1160106903 | 18:75986926-75986948 | CCACTTGGAAATGAACTTGGGCC | No data | ||
Right | 1160106914 | 18:75986977-75986999 | CTGTGAGTCCCCATTTCACAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1160106903 | Original CRISPR | GGCCCAAGTTCATTTCCAAG TGG (reversed) | Intergenic | ||