ID: 1160106909

View in Genome Browser
Species Human (GRCh38)
Location 18:75986957-75986979
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160106909_1160106924 29 Left 1160106909 18:75986957-75986979 CCCTGCATATCTCCTGACCTCTG No data
Right 1160106924 18:75987009-75987031 GGATAGTGCTTTGGGTTCTCTGG No data
1160106909_1160106922 20 Left 1160106909 18:75986957-75986979 CCCTGCATATCTCCTGACCTCTG No data
Right 1160106922 18:75987000-75987022 AGTGGGGCAGGATAGTGCTTTGG No data
1160106909_1160106921 8 Left 1160106909 18:75986957-75986979 CCCTGCATATCTCCTGACCTCTG No data
Right 1160106921 18:75986988-75987010 CATTTCACAGGGAGTGGGGCAGG No data
1160106909_1160106914 -3 Left 1160106909 18:75986957-75986979 CCCTGCATATCTCCTGACCTCTG No data
Right 1160106914 18:75986977-75986999 CTGTGAGTCCCCATTTCACAGGG No data
1160106909_1160106917 4 Left 1160106909 18:75986957-75986979 CCCTGCATATCTCCTGACCTCTG No data
Right 1160106917 18:75986984-75987006 TCCCCATTTCACAGGGAGTGGGG No data
1160106909_1160106913 -4 Left 1160106909 18:75986957-75986979 CCCTGCATATCTCCTGACCTCTG No data
Right 1160106913 18:75986976-75986998 TCTGTGAGTCCCCATTTCACAGG No data
1160106909_1160106915 2 Left 1160106909 18:75986957-75986979 CCCTGCATATCTCCTGACCTCTG No data
Right 1160106915 18:75986982-75987004 AGTCCCCATTTCACAGGGAGTGG No data
1160106909_1160106916 3 Left 1160106909 18:75986957-75986979 CCCTGCATATCTCCTGACCTCTG No data
Right 1160106916 18:75986983-75987005 GTCCCCATTTCACAGGGAGTGGG No data
1160106909_1160106923 21 Left 1160106909 18:75986957-75986979 CCCTGCATATCTCCTGACCTCTG No data
Right 1160106923 18:75987001-75987023 GTGGGGCAGGATAGTGCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160106909 Original CRISPR CAGAGGTCAGGAGATATGCA GGG (reversed) Intergenic
No off target data available for this crispr