ID: 1160106914

View in Genome Browser
Species Human (GRCh38)
Location 18:75986977-75986999
Sequence CTGTGAGTCCCCATTTCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160106909_1160106914 -3 Left 1160106909 18:75986957-75986979 CCCTGCATATCTCCTGACCTCTG No data
Right 1160106914 18:75986977-75986999 CTGTGAGTCCCCATTTCACAGGG No data
1160106908_1160106914 7 Left 1160106908 18:75986947-75986969 CCAGGGCGGGCCCTGCATATCTC No data
Right 1160106914 18:75986977-75986999 CTGTGAGTCCCCATTTCACAGGG No data
1160106903_1160106914 28 Left 1160106903 18:75986926-75986948 CCACTTGGAAATGAACTTGGGCC No data
Right 1160106914 18:75986977-75986999 CTGTGAGTCCCCATTTCACAGGG No data
1160106910_1160106914 -4 Left 1160106910 18:75986958-75986980 CCTGCATATCTCCTGACCTCTGT No data
Right 1160106914 18:75986977-75986999 CTGTGAGTCCCCATTTCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160106914 Original CRISPR CTGTGAGTCCCCATTTCACA GGG Intergenic
No off target data available for this crispr