ID: 1160106917

View in Genome Browser
Species Human (GRCh38)
Location 18:75986984-75987006
Sequence TCCCCATTTCACAGGGAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160106909_1160106917 4 Left 1160106909 18:75986957-75986979 CCCTGCATATCTCCTGACCTCTG No data
Right 1160106917 18:75986984-75987006 TCCCCATTTCACAGGGAGTGGGG No data
1160106911_1160106917 -8 Left 1160106911 18:75986969-75986991 CCTGACCTCTGTGAGTCCCCATT No data
Right 1160106917 18:75986984-75987006 TCCCCATTTCACAGGGAGTGGGG No data
1160106908_1160106917 14 Left 1160106908 18:75986947-75986969 CCAGGGCGGGCCCTGCATATCTC No data
Right 1160106917 18:75986984-75987006 TCCCCATTTCACAGGGAGTGGGG No data
1160106910_1160106917 3 Left 1160106910 18:75986958-75986980 CCTGCATATCTCCTGACCTCTGT No data
Right 1160106917 18:75986984-75987006 TCCCCATTTCACAGGGAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160106917 Original CRISPR TCCCCATTTCACAGGGAGTG GGG Intergenic
No off target data available for this crispr