ID: 1160106922

View in Genome Browser
Species Human (GRCh38)
Location 18:75987000-75987022
Sequence AGTGGGGCAGGATAGTGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160106919_1160106922 -9 Left 1160106919 18:75986986-75987008 CCCATTTCACAGGGAGTGGGGCA No data
Right 1160106922 18:75987000-75987022 AGTGGGGCAGGATAGTGCTTTGG No data
1160106911_1160106922 8 Left 1160106911 18:75986969-75986991 CCTGACCTCTGTGAGTCCCCATT No data
Right 1160106922 18:75987000-75987022 AGTGGGGCAGGATAGTGCTTTGG No data
1160106910_1160106922 19 Left 1160106910 18:75986958-75986980 CCTGCATATCTCCTGACCTCTGT No data
Right 1160106922 18:75987000-75987022 AGTGGGGCAGGATAGTGCTTTGG No data
1160106912_1160106922 3 Left 1160106912 18:75986974-75986996 CCTCTGTGAGTCCCCATTTCACA No data
Right 1160106922 18:75987000-75987022 AGTGGGGCAGGATAGTGCTTTGG No data
1160106918_1160106922 -8 Left 1160106918 18:75986985-75987007 CCCCATTTCACAGGGAGTGGGGC No data
Right 1160106922 18:75987000-75987022 AGTGGGGCAGGATAGTGCTTTGG No data
1160106908_1160106922 30 Left 1160106908 18:75986947-75986969 CCAGGGCGGGCCCTGCATATCTC No data
Right 1160106922 18:75987000-75987022 AGTGGGGCAGGATAGTGCTTTGG No data
1160106920_1160106922 -10 Left 1160106920 18:75986987-75987009 CCATTTCACAGGGAGTGGGGCAG No data
Right 1160106922 18:75987000-75987022 AGTGGGGCAGGATAGTGCTTTGG No data
1160106909_1160106922 20 Left 1160106909 18:75986957-75986979 CCCTGCATATCTCCTGACCTCTG No data
Right 1160106922 18:75987000-75987022 AGTGGGGCAGGATAGTGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160106922 Original CRISPR AGTGGGGCAGGATAGTGCTT TGG Intergenic
No off target data available for this crispr