ID: 1160112554

View in Genome Browser
Species Human (GRCh38)
Location 18:76047514-76047536
Sequence GATTATGCACTATTGGCGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160112554_1160112560 -6 Left 1160112554 18:76047514-76047536 CCTGCCGCCAATAGTGCATAATC No data
Right 1160112560 18:76047531-76047553 ATAATCGAATTAGGGAGCCAGGG No data
1160112554_1160112559 -7 Left 1160112554 18:76047514-76047536 CCTGCCGCCAATAGTGCATAATC No data
Right 1160112559 18:76047530-76047552 CATAATCGAATTAGGGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160112554 Original CRISPR GATTATGCACTATTGGCGGC AGG (reversed) Intergenic
No off target data available for this crispr