ID: 1160117719

View in Genome Browser
Species Human (GRCh38)
Location 18:76097463-76097485
Sequence AAGAGCATGGGCCAGTTATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160117719_1160117724 29 Left 1160117719 18:76097463-76097485 CCACATAACTGGCCCATGCTCTT No data
Right 1160117724 18:76097515-76097537 TGAGGGACCCCACTAATACGAGG No data
1160117719_1160117722 11 Left 1160117719 18:76097463-76097485 CCACATAACTGGCCCATGCTCTT No data
Right 1160117722 18:76097497-76097519 CTCATGAGTGAAAGACACTGAGG No data
1160117719_1160117723 12 Left 1160117719 18:76097463-76097485 CCACATAACTGGCCCATGCTCTT No data
Right 1160117723 18:76097498-76097520 TCATGAGTGAAAGACACTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160117719 Original CRISPR AAGAGCATGGGCCAGTTATG TGG (reversed) Intergenic
No off target data available for this crispr