ID: 1160118934

View in Genome Browser
Species Human (GRCh38)
Location 18:76109597-76109619
Sequence CTGTATTTAGTGAGAGAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160118930_1160118934 30 Left 1160118930 18:76109544-76109566 CCGTATTTTAGAGTCTTCTCTTG No data
Right 1160118934 18:76109597-76109619 CTGTATTTAGTGAGAGAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160118934 Original CRISPR CTGTATTTAGTGAGAGAAAT AGG Intergenic
No off target data available for this crispr