ID: 1160120848

View in Genome Browser
Species Human (GRCh38)
Location 18:76129453-76129475
Sequence ACATCTGAGGGCCTCATCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160120848_1160120856 22 Left 1160120848 18:76129453-76129475 CCTGTGATGAGGCCCTCAGATGT No data
Right 1160120856 18:76129498-76129520 CAAACCTGTGAGGCCAGGTGTGG No data
1160120848_1160120853 12 Left 1160120848 18:76129453-76129475 CCTGTGATGAGGCCCTCAGATGT No data
Right 1160120853 18:76129488-76129510 ATTCCTATAGCAAACCTGTGAGG No data
1160120848_1160120857 23 Left 1160120848 18:76129453-76129475 CCTGTGATGAGGCCCTCAGATGT No data
Right 1160120857 18:76129499-76129521 AAACCTGTGAGGCCAGGTGTGGG No data
1160120848_1160120855 17 Left 1160120848 18:76129453-76129475 CCTGTGATGAGGCCCTCAGATGT No data
Right 1160120855 18:76129493-76129515 TATAGCAAACCTGTGAGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160120848 Original CRISPR ACATCTGAGGGCCTCATCAC AGG (reversed) Intergenic
No off target data available for this crispr