ID: 1160123917

View in Genome Browser
Species Human (GRCh38)
Location 18:76153529-76153551
Sequence TGGTGGAAATGGAGGTGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160123911_1160123917 0 Left 1160123911 18:76153506-76153528 CCAGTGGGTTAAAGAACAAGGCG No data
Right 1160123917 18:76153529-76153551 TGGTGGAAATGGAGGTGACAGGG No data
1160123910_1160123917 1 Left 1160123910 18:76153505-76153527 CCCAGTGGGTTAAAGAACAAGGC No data
Right 1160123917 18:76153529-76153551 TGGTGGAAATGGAGGTGACAGGG No data
1160123906_1160123917 19 Left 1160123906 18:76153487-76153509 CCAGGTATTGGTCAGCAACCCAG No data
Right 1160123917 18:76153529-76153551 TGGTGGAAATGGAGGTGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160123917 Original CRISPR TGGTGGAAATGGAGGTGACA GGG Intergenic
No off target data available for this crispr