ID: 1160131194

View in Genome Browser
Species Human (GRCh38)
Location 18:76226293-76226315
Sequence GCTCCAGCCAGGGTGTTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160131194_1160131197 -8 Left 1160131194 18:76226293-76226315 CCTTCAAACACCCTGGCTGGAGC No data
Right 1160131197 18:76226308-76226330 GCTGGAGCTGCACACACAGAAGG No data
1160131194_1160131199 6 Left 1160131194 18:76226293-76226315 CCTTCAAACACCCTGGCTGGAGC No data
Right 1160131199 18:76226322-76226344 CACAGAAGGAGAAAGGTCCCCGG No data
1160131194_1160131198 -1 Left 1160131194 18:76226293-76226315 CCTTCAAACACCCTGGCTGGAGC No data
Right 1160131198 18:76226315-76226337 CTGCACACACAGAAGGAGAAAGG No data
1160131194_1160131200 16 Left 1160131194 18:76226293-76226315 CCTTCAAACACCCTGGCTGGAGC No data
Right 1160131200 18:76226332-76226354 GAAAGGTCCCCGGAGACCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160131194 Original CRISPR GCTCCAGCCAGGGTGTTTGA AGG (reversed) Intergenic
No off target data available for this crispr