ID: 1160131198

View in Genome Browser
Species Human (GRCh38)
Location 18:76226315-76226337
Sequence CTGCACACACAGAAGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160131194_1160131198 -1 Left 1160131194 18:76226293-76226315 CCTTCAAACACCCTGGCTGGAGC No data
Right 1160131198 18:76226315-76226337 CTGCACACACAGAAGGAGAAAGG No data
1160131191_1160131198 15 Left 1160131191 18:76226277-76226299 CCTAAAGAATGTTCTACCTTCAA No data
Right 1160131198 18:76226315-76226337 CTGCACACACAGAAGGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160131198 Original CRISPR CTGCACACACAGAAGGAGAA AGG Intergenic
No off target data available for this crispr