ID: 1160131309

View in Genome Browser
Species Human (GRCh38)
Location 18:76227247-76227269
Sequence TTGAAGGTAGAACATTCTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160131309_1160131317 15 Left 1160131309 18:76227247-76227269 CCTAAAGAATGTTCTACCTTCAA No data
Right 1160131317 18:76227285-76227307 CTGCACACACAGAAGGAGAAAGG No data
1160131309_1160131318 22 Left 1160131309 18:76227247-76227269 CCTAAAGAATGTTCTACCTTCAA No data
Right 1160131318 18:76227292-76227314 CACAGAAGGAGAAAGGTCCCCGG No data
1160131309_1160131316 8 Left 1160131309 18:76227247-76227269 CCTAAAGAATGTTCTACCTTCAA No data
Right 1160131316 18:76227278-76227300 GGTGGAGCTGCACACACAGAAGG No data
1160131309_1160131312 -10 Left 1160131309 18:76227247-76227269 CCTAAAGAATGTTCTACCTTCAA No data
Right 1160131312 18:76227260-76227282 CTACCTTCAAATACCCTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160131309 Original CRISPR TTGAAGGTAGAACATTCTTT AGG (reversed) Intergenic
No off target data available for this crispr