ID: 1160131313

View in Genome Browser
Species Human (GRCh38)
Location 18:76227263-76227285
Sequence GCTCCACCCAGGGTATTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160131313_1160131317 -1 Left 1160131313 18:76227263-76227285 CCTTCAAATACCCTGGGTGGAGC No data
Right 1160131317 18:76227285-76227307 CTGCACACACAGAAGGAGAAAGG No data
1160131313_1160131319 16 Left 1160131313 18:76227263-76227285 CCTTCAAATACCCTGGGTGGAGC No data
Right 1160131319 18:76227302-76227324 GAAAGGTCCCCGGAGACCACAGG No data
1160131313_1160131318 6 Left 1160131313 18:76227263-76227285 CCTTCAAATACCCTGGGTGGAGC No data
Right 1160131318 18:76227292-76227314 CACAGAAGGAGAAAGGTCCCCGG No data
1160131313_1160131316 -8 Left 1160131313 18:76227263-76227285 CCTTCAAATACCCTGGGTGGAGC No data
Right 1160131316 18:76227278-76227300 GGTGGAGCTGCACACACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160131313 Original CRISPR GCTCCACCCAGGGTATTTGA AGG (reversed) Intergenic
No off target data available for this crispr