ID: 1160131317

View in Genome Browser
Species Human (GRCh38)
Location 18:76227285-76227307
Sequence CTGCACACACAGAAGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160131313_1160131317 -1 Left 1160131313 18:76227263-76227285 CCTTCAAATACCCTGGGTGGAGC No data
Right 1160131317 18:76227285-76227307 CTGCACACACAGAAGGAGAAAGG No data
1160131309_1160131317 15 Left 1160131309 18:76227247-76227269 CCTAAAGAATGTTCTACCTTCAA No data
Right 1160131317 18:76227285-76227307 CTGCACACACAGAAGGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160131317 Original CRISPR CTGCACACACAGAAGGAGAA AGG Intergenic
No off target data available for this crispr