ID: 1160131626

View in Genome Browser
Species Human (GRCh38)
Location 18:76230550-76230572
Sequence CTCACTGCTCTGGAAGGGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160131613_1160131626 23 Left 1160131613 18:76230504-76230526 CCAAGGAAGGGGAGAGCGACCTG No data
Right 1160131626 18:76230550-76230572 CTCACTGCTCTGGAAGGGTAGGG No data
1160131619_1160131626 -4 Left 1160131619 18:76230531-76230553 CCAGGGTGCCAAGGACCAACTCA No data
Right 1160131626 18:76230550-76230572 CTCACTGCTCTGGAAGGGTAGGG No data
1160131618_1160131626 4 Left 1160131618 18:76230523-76230545 CCTGAAGGCCAGGGTGCCAAGGA No data
Right 1160131626 18:76230550-76230572 CTCACTGCTCTGGAAGGGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160131626 Original CRISPR CTCACTGCTCTGGAAGGGTA GGG Intergenic
No off target data available for this crispr