ID: 1160131683

View in Genome Browser
Species Human (GRCh38)
Location 18:76231022-76231044
Sequence AGGGGAGCACGCTGTGATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160131683_1160131694 29 Left 1160131683 18:76231022-76231044 CCTGCATCACAGCGTGCTCCCCT No data
Right 1160131694 18:76231074-76231096 CCAGTGACCAGTGGCCACGCCGG No data
1160131683_1160131688 2 Left 1160131683 18:76231022-76231044 CCTGCATCACAGCGTGCTCCCCT No data
Right 1160131688 18:76231047-76231069 GAGTCCTGCTGTCCTAGGACAGG No data
1160131683_1160131687 -3 Left 1160131683 18:76231022-76231044 CCTGCATCACAGCGTGCTCCCCT No data
Right 1160131687 18:76231042-76231064 CCTCAGAGTCCTGCTGTCCTAGG No data
1160131683_1160131691 20 Left 1160131683 18:76231022-76231044 CCTGCATCACAGCGTGCTCCCCT No data
Right 1160131691 18:76231065-76231087 ACAGGCTGCCCAGTGACCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160131683 Original CRISPR AGGGGAGCACGCTGTGATGC AGG (reversed) Intergenic