ID: 1160131685

View in Genome Browser
Species Human (GRCh38)
Location 18:76231041-76231063
Sequence CTAGGACAGCAGGACTCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160131685_1160131691 1 Left 1160131685 18:76231041-76231063 CCCTCAGAGTCCTGCTGTCCTAG No data
Right 1160131691 18:76231065-76231087 ACAGGCTGCCCAGTGACCAGTGG No data
1160131685_1160131696 18 Left 1160131685 18:76231041-76231063 CCCTCAGAGTCCTGCTGTCCTAG No data
Right 1160131696 18:76231082-76231104 CAGTGGCCACGCCGGCCCCCAGG No data
1160131685_1160131698 23 Left 1160131685 18:76231041-76231063 CCCTCAGAGTCCTGCTGTCCTAG No data
Right 1160131698 18:76231087-76231109 GCCACGCCGGCCCCCAGGGATGG No data
1160131685_1160131697 19 Left 1160131685 18:76231041-76231063 CCCTCAGAGTCCTGCTGTCCTAG No data
Right 1160131697 18:76231083-76231105 AGTGGCCACGCCGGCCCCCAGGG No data
1160131685_1160131694 10 Left 1160131685 18:76231041-76231063 CCCTCAGAGTCCTGCTGTCCTAG No data
Right 1160131694 18:76231074-76231096 CCAGTGACCAGTGGCCACGCCGG No data
1160131685_1160131700 27 Left 1160131685 18:76231041-76231063 CCCTCAGAGTCCTGCTGTCCTAG No data
Right 1160131700 18:76231091-76231113 CGCCGGCCCCCAGGGATGGATGG 0: 1
1: 0
2: 1
3: 8
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160131685 Original CRISPR CTAGGACAGCAGGACTCTGA GGG (reversed) Intergenic