ID: 1160131690 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 18:76231059-76231081 |
Sequence | GTCACTGGGCAGCCTGTCCT AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 5 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1160131690_1160131700 | 9 | Left | 1160131690 | 18:76231059-76231081 | CCTAGGACAGGCTGCCCAGTGAC | No data | ||
Right | 1160131700 | 18:76231091-76231113 | CGCCGGCCCCCAGGGATGGATGG | No data | ||||
1160131690_1160131696 | 0 | Left | 1160131690 | 18:76231059-76231081 | CCTAGGACAGGCTGCCCAGTGAC | No data | ||
Right | 1160131696 | 18:76231082-76231104 | CAGTGGCCACGCCGGCCCCCAGG | No data | ||||
1160131690_1160131694 | -8 | Left | 1160131690 | 18:76231059-76231081 | CCTAGGACAGGCTGCCCAGTGAC | No data | ||
Right | 1160131694 | 18:76231074-76231096 | CCAGTGACCAGTGGCCACGCCGG | No data | ||||
1160131690_1160131697 | 1 | Left | 1160131690 | 18:76231059-76231081 | CCTAGGACAGGCTGCCCAGTGAC | No data | ||
Right | 1160131697 | 18:76231083-76231105 | AGTGGCCACGCCGGCCCCCAGGG | No data | ||||
1160131690_1160131698 | 5 | Left | 1160131690 | 18:76231059-76231081 | CCTAGGACAGGCTGCCCAGTGAC | No data | ||
Right | 1160131698 | 18:76231087-76231109 | GCCACGCCGGCCCCCAGGGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1160131690 | Original CRISPR | GTCACTGGGCAGCCTGTCCT AGG (reversed) | Intergenic | ||