ID: 1160131690

View in Genome Browser
Species Human (GRCh38)
Location 18:76231059-76231081
Sequence GTCACTGGGCAGCCTGTCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160131690_1160131700 9 Left 1160131690 18:76231059-76231081 CCTAGGACAGGCTGCCCAGTGAC No data
Right 1160131700 18:76231091-76231113 CGCCGGCCCCCAGGGATGGATGG No data
1160131690_1160131696 0 Left 1160131690 18:76231059-76231081 CCTAGGACAGGCTGCCCAGTGAC No data
Right 1160131696 18:76231082-76231104 CAGTGGCCACGCCGGCCCCCAGG No data
1160131690_1160131694 -8 Left 1160131690 18:76231059-76231081 CCTAGGACAGGCTGCCCAGTGAC No data
Right 1160131694 18:76231074-76231096 CCAGTGACCAGTGGCCACGCCGG No data
1160131690_1160131697 1 Left 1160131690 18:76231059-76231081 CCTAGGACAGGCTGCCCAGTGAC No data
Right 1160131697 18:76231083-76231105 AGTGGCCACGCCGGCCCCCAGGG No data
1160131690_1160131698 5 Left 1160131690 18:76231059-76231081 CCTAGGACAGGCTGCCCAGTGAC No data
Right 1160131698 18:76231087-76231109 GCCACGCCGGCCCCCAGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160131690 Original CRISPR GTCACTGGGCAGCCTGTCCT AGG (reversed) Intergenic