ID: 1160131691

View in Genome Browser
Species Human (GRCh38)
Location 18:76231065-76231087
Sequence ACAGGCTGCCCAGTGACCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160131689_1160131691 -9 Left 1160131689 18:76231051-76231073 CCTGCTGTCCTAGGACAGGCTGC No data
Right 1160131691 18:76231065-76231087 ACAGGCTGCCCAGTGACCAGTGG No data
1160131686_1160131691 0 Left 1160131686 18:76231042-76231064 CCTCAGAGTCCTGCTGTCCTAGG No data
Right 1160131691 18:76231065-76231087 ACAGGCTGCCCAGTGACCAGTGG No data
1160131685_1160131691 1 Left 1160131685 18:76231041-76231063 CCCTCAGAGTCCTGCTGTCCTAG No data
Right 1160131691 18:76231065-76231087 ACAGGCTGCCCAGTGACCAGTGG No data
1160131684_1160131691 2 Left 1160131684 18:76231040-76231062 CCCCTCAGAGTCCTGCTGTCCTA No data
Right 1160131691 18:76231065-76231087 ACAGGCTGCCCAGTGACCAGTGG No data
1160131683_1160131691 20 Left 1160131683 18:76231022-76231044 CCTGCATCACAGCGTGCTCCCCT No data
Right 1160131691 18:76231065-76231087 ACAGGCTGCCCAGTGACCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160131691 Original CRISPR ACAGGCTGCCCAGTGACCAG TGG Intergenic
No off target data available for this crispr