ID: 1160131697

View in Genome Browser
Species Human (GRCh38)
Location 18:76231083-76231105
Sequence AGTGGCCACGCCGGCCCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160131689_1160131697 9 Left 1160131689 18:76231051-76231073 CCTGCTGTCCTAGGACAGGCTGC No data
Right 1160131697 18:76231083-76231105 AGTGGCCACGCCGGCCCCCAGGG No data
1160131690_1160131697 1 Left 1160131690 18:76231059-76231081 CCTAGGACAGGCTGCCCAGTGAC No data
Right 1160131697 18:76231083-76231105 AGTGGCCACGCCGGCCCCCAGGG No data
1160131686_1160131697 18 Left 1160131686 18:76231042-76231064 CCTCAGAGTCCTGCTGTCCTAGG No data
Right 1160131697 18:76231083-76231105 AGTGGCCACGCCGGCCCCCAGGG No data
1160131684_1160131697 20 Left 1160131684 18:76231040-76231062 CCCCTCAGAGTCCTGCTGTCCTA No data
Right 1160131697 18:76231083-76231105 AGTGGCCACGCCGGCCCCCAGGG No data
1160131685_1160131697 19 Left 1160131685 18:76231041-76231063 CCCTCAGAGTCCTGCTGTCCTAG No data
Right 1160131697 18:76231083-76231105 AGTGGCCACGCCGGCCCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160131697 Original CRISPR AGTGGCCACGCCGGCCCCCA GGG Intergenic