ID: 1160131700

View in Genome Browser
Species Human (GRCh38)
Location 18:76231091-76231113
Sequence CGCCGGCCCCCAGGGATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160131692_1160131700 -5 Left 1160131692 18:76231073-76231095 CCCAGTGACCAGTGGCCACGCCG No data
Right 1160131700 18:76231091-76231113 CGCCGGCCCCCAGGGATGGATGG No data
1160131685_1160131700 27 Left 1160131685 18:76231041-76231063 CCCTCAGAGTCCTGCTGTCCTAG No data
Right 1160131700 18:76231091-76231113 CGCCGGCCCCCAGGGATGGATGG No data
1160131693_1160131700 -6 Left 1160131693 18:76231074-76231096 CCAGTGACCAGTGGCCACGCCGG No data
Right 1160131700 18:76231091-76231113 CGCCGGCCCCCAGGGATGGATGG No data
1160131689_1160131700 17 Left 1160131689 18:76231051-76231073 CCTGCTGTCCTAGGACAGGCTGC No data
Right 1160131700 18:76231091-76231113 CGCCGGCCCCCAGGGATGGATGG No data
1160131686_1160131700 26 Left 1160131686 18:76231042-76231064 CCTCAGAGTCCTGCTGTCCTAGG No data
Right 1160131700 18:76231091-76231113 CGCCGGCCCCCAGGGATGGATGG No data
1160131690_1160131700 9 Left 1160131690 18:76231059-76231081 CCTAGGACAGGCTGCCCAGTGAC No data
Right 1160131700 18:76231091-76231113 CGCCGGCCCCCAGGGATGGATGG No data
1160131684_1160131700 28 Left 1160131684 18:76231040-76231062 CCCCTCAGAGTCCTGCTGTCCTA No data
Right 1160131700 18:76231091-76231113 CGCCGGCCCCCAGGGATGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160131700 Original CRISPR CGCCGGCCCCCAGGGATGGA TGG Intergenic