ID: 1160135414

View in Genome Browser
Species Human (GRCh38)
Location 18:76267113-76267135
Sequence TTTGACCTATAGAAGGTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160135414_1160135421 12 Left 1160135414 18:76267113-76267135 CCATGCACCTTCTATAGGTCAAA No data
Right 1160135421 18:76267148-76267170 CCAAGAGCTGTAGAAGCCTAGGG No data
1160135414_1160135419 11 Left 1160135414 18:76267113-76267135 CCATGCACCTTCTATAGGTCAAA No data
Right 1160135419 18:76267147-76267169 ACCAAGAGCTGTAGAAGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160135414 Original CRISPR TTTGACCTATAGAAGGTGCA TGG (reversed) Intergenic
No off target data available for this crispr