ID: 1160139312

View in Genome Browser
Species Human (GRCh38)
Location 18:76306793-76306815
Sequence TGCCTAGCAAAGGTCGGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160139312_1160139319 7 Left 1160139312 18:76306793-76306815 CCCTTTCCGACCTTTGCTAGGCA No data
Right 1160139319 18:76306823-76306845 GGCCCTGGACATGCTTATGGCGG No data
1160139312_1160139318 4 Left 1160139312 18:76306793-76306815 CCCTTTCCGACCTTTGCTAGGCA No data
Right 1160139318 18:76306820-76306842 CATGGCCCTGGACATGCTTATGG No data
1160139312_1160139317 -8 Left 1160139312 18:76306793-76306815 CCCTTTCCGACCTTTGCTAGGCA No data
Right 1160139317 18:76306808-76306830 GCTAGGCATGCACATGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160139312 Original CRISPR TGCCTAGCAAAGGTCGGAAA GGG (reversed) Intergenic
No off target data available for this crispr