ID: 1160142371

View in Genome Browser
Species Human (GRCh38)
Location 18:76337130-76337152
Sequence AACGGGTATTTCCTGTGTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160142362_1160142371 30 Left 1160142362 18:76337077-76337099 CCTGCATCATGCCTCACCACCGA No data
Right 1160142371 18:76337130-76337152 AACGGGTATTTCCTGTGTATAGG No data
1160142366_1160142371 11 Left 1160142366 18:76337096-76337118 CCGAGCCTCGTGTGCTGTGTGGT No data
Right 1160142371 18:76337130-76337152 AACGGGTATTTCCTGTGTATAGG No data
1160142367_1160142371 6 Left 1160142367 18:76337101-76337123 CCTCGTGTGCTGTGTGGTCCATA No data
Right 1160142371 18:76337130-76337152 AACGGGTATTTCCTGTGTATAGG No data
1160142364_1160142371 14 Left 1160142364 18:76337093-76337115 CCACCGAGCCTCGTGTGCTGTGT No data
Right 1160142371 18:76337130-76337152 AACGGGTATTTCCTGTGTATAGG No data
1160142363_1160142371 19 Left 1160142363 18:76337088-76337110 CCTCACCACCGAGCCTCGTGTGC No data
Right 1160142371 18:76337130-76337152 AACGGGTATTTCCTGTGTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160142371 Original CRISPR AACGGGTATTTCCTGTGTAT AGG Intergenic
No off target data available for this crispr