ID: 1160148153

View in Genome Browser
Species Human (GRCh38)
Location 18:76380668-76380690
Sequence TTCGAGGAACTCTACATTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 79}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160148153 Original CRISPR TTCGAGGAACTCTACATTTA GGG Intronic
902278680 1:15358740-15358762 TTCGAGGCCCTCCACAATTAGGG + Intronic
904505272 1:30947745-30947767 TTTGAGGTACTCAACATTTTGGG - Intronic
909177044 1:72374063-72374085 TTGCAGGAATTCTACATTTTGGG + Intergenic
911124956 1:94332744-94332766 GTCAGGGAACTCTACATATAAGG + Intergenic
916550260 1:165843359-165843381 TTAAATGAACCCTACATTTATGG + Intronic
916657149 1:166886340-166886362 TTTGTGGAACTGTACCTTTATGG + Intergenic
919002025 1:191844881-191844903 TTGGAGGAACACTATGTTTATGG + Intergenic
922464766 1:225839273-225839295 TTCCAGGAATTCTACATTCAAGG + Exonic
923088967 1:230723931-230723953 TTCCAGGAGCTCTCTATTTATGG + Intergenic
1064526922 10:16266684-16266706 TGTGAGGAACTCAACATTTTAGG - Intergenic
1065270389 10:24026088-24026110 TTAGAGCAACTTTACATTTCTGG + Intronic
1070405936 10:76095004-76095026 TTCATGGAACTCTACACTAAGGG - Intronic
1074061461 10:109969915-109969937 TTCCAGGACCTCTTCAGTTAAGG + Intergenic
1078484562 11:11709578-11709600 TTCAAGGAACTCACCATTCAGGG - Intergenic
1080146067 11:28985597-28985619 TTTGCGGATCTCTAGATTTACGG - Intergenic
1082691534 11:56310435-56310457 TTCTAGGAACTTTAAATTTCAGG + Intergenic
1087335877 11:96843830-96843852 TTTGAGACACTCTACATTGATGG + Intergenic
1087821675 11:102719403-102719425 TTGTAGGTACTCTACAATTATGG - Intronic
1094008971 12:25786070-25786092 TTCTAGAAACTCTGCATGTATGG + Intergenic
1095578350 12:43765265-43765287 TTATAGGTACTCTTCATTTAGGG + Intronic
1097927068 12:65140607-65140629 TTTGAGGAACTATAAATTTAGGG + Intergenic
1101792658 12:107942165-107942187 TTGGAGGACCTCTACAGTGAAGG + Intergenic
1113886052 13:113658846-113658868 TTTGAGGACCACTAGATTTAGGG - Intergenic
1115082731 14:29477026-29477048 TTTCAGGAACTTTACATTCATGG + Intergenic
1120509537 14:85396697-85396719 TCCGAGGAACTTTAGTTTTAAGG + Intergenic
1124693975 15:31848099-31848121 TTCGAGGGACTCTGCAGTTAGGG - Intronic
1124995249 15:34717297-34717319 TTAGAGGAACTATATTTTTAAGG - Intergenic
1127004997 15:54558943-54558965 TTGAAAGAAATCTACATTTAGGG - Intronic
1127450422 15:59111138-59111160 TTCAAGGAATTCTAAATTAAGGG + Intronic
1133293323 16:4737050-4737072 TTCGAGGGATTCTGCATTTGTGG + Intronic
1138275686 16:55732520-55732542 TTCGAGGAAAACTTCCTTTATGG - Intergenic
1139323744 16:66135522-66135544 TAGGAGGAACTCTCCTTTTAAGG - Intergenic
1149303633 17:55328087-55328109 TTAGAGGAAATTTACATGTAGGG - Intergenic
1154012049 18:10582623-10582645 TTCGAACAACTCAAAATTTAAGG + Intergenic
1155821169 18:30379667-30379689 TTGGTGGTACTATACATTTACGG - Intergenic
1155841052 18:30643191-30643213 TTATAGGCACTCTACTTTTAAGG + Intergenic
1157647532 18:49291507-49291529 TTTGAGGACCTCGAAATTTAGGG - Intronic
1159441725 18:68489077-68489099 TTGGAGGAAGAGTACATTTAGGG - Intergenic
1159664596 18:71142661-71142683 CTAGAGGAAATCTATATTTAGGG + Intergenic
1160148153 18:76380668-76380690 TTCGAGGAACTCTACATTTAGGG + Intronic
1163821686 19:19499742-19499764 TACAAGCAACTCTACATTTGAGG - Intronic
926620506 2:15042756-15042778 TTCCAGAATCTCTCCATTTATGG - Intergenic
928838475 2:35575977-35575999 TTAGAGGGACTCTCCATTTCAGG - Intergenic
933096895 2:78195563-78195585 ACCAAGGAATTCTACATTTAAGG + Intergenic
935373574 2:102372897-102372919 ATCCAGTAATTCTACATTTAGGG - Intronic
936430576 2:112458986-112459008 TTCGATGAATTCTACCTTTCAGG - Intergenic
946660165 2:221991169-221991191 TTCTAGGAACTCTGCTTTGAAGG + Intergenic
946680911 2:222215047-222215069 TGAGAGGAACTCAAAATTTATGG + Intronic
947191400 2:227509538-227509560 TTTTAGGAAATATACATTTAGGG + Intronic
1175151727 20:56940282-56940304 TTCTTGGCACTCTACATTAAAGG + Intergenic
1178719609 21:34996562-34996584 TTCCAGGAACTCTGCTTTTTAGG - Intronic
951109005 3:18779008-18779030 TTTGAGTAAATCAACATTTAGGG - Intergenic
957027972 3:75206483-75206505 TTATAAGAACTCTGCATTTATGG - Intergenic
957210283 3:77249939-77249961 CTTGAAGAACTCTGCATTTAAGG + Intronic
957224170 3:77421943-77421965 TTTGAGGAACTCTAAATTAGAGG - Intronic
958045202 3:88275949-88275971 TTCATGGAACTCAGCATTTATGG - Intergenic
960880383 3:122339053-122339075 TCTGAGGCACTCTAGATTTAAGG + Intronic
963809551 3:149762153-149762175 TTGGAGGACCCCAACATTTAAGG - Intronic
965155694 3:165051136-165051158 TCAGAGGAACTCAATATTTATGG - Intronic
965538579 3:169850227-169850249 TTTGAAGAACTCTATATTTAGGG + Intronic
965710354 3:171550669-171550691 GTCGAGGAATTCTACAATGATGG + Intergenic
975056965 4:69945655-69945677 CTCAAGGAACTCCACAGTTAGGG + Intronic
979818744 4:125143891-125143913 TTTGAGAAACTTTACATTTGAGG + Intergenic
980443732 4:132881101-132881123 TTCTAGGAACTCTGGATTTCTGG - Intergenic
981107845 4:140901691-140901713 TTTGAGGATCTATAAATTTAAGG + Intronic
988664306 5:33308430-33308452 TTAGAGGAAAGGTACATTTATGG - Intergenic
989512092 5:42300042-42300064 TTTAAGGAACTTTAGATTTATGG + Intergenic
991100496 5:62786933-62786955 TTTGAGGAACTCTGTATTGACGG + Intergenic
993380893 5:87205823-87205845 TCCGAGCAATGCTACATTTAGGG + Intergenic
996139114 5:119883652-119883674 TCCTAAGAACTCTACTTTTAGGG - Intergenic
1001626679 5:173141978-173142000 TTCCAGGAACTCTATATATTAGG - Intergenic
1002425889 5:179175515-179175537 TTCCAGGTATTCTACATTTTTGG + Intronic
1012053832 6:94379747-94379769 TCTGAAGAACTCTAAATTTAAGG + Intergenic
1012507333 6:99962627-99962649 TTCGAGGAGTTTTACATTTCTGG - Intronic
1013182625 6:107731071-107731093 TTGGAGGTTCTCTACATTTCAGG - Intronic
1023485039 7:40677222-40677244 TTCGGCCAACTCTACATTTTAGG + Intronic
1028894660 7:96027658-96027680 TTCCTGGAAGTCTACATTAAGGG + Intronic
1037761367 8:21743964-21743986 TTCAAGGACCTCTACTTTAAAGG + Intronic
1045160050 8:99530075-99530097 TACGAAGAACTTTACATTGATGG + Intronic
1046856982 8:119043478-119043500 TTCAAGAAACTCTACAGTTTTGG - Intronic
1052870796 9:33504403-33504425 TTTTTGGAAGTCTACATTTAAGG + Intergenic
1053671761 9:40372266-40372288 TTAGAGGAGTTCTACATTTAAGG + Intergenic
1053921574 9:42998624-42998646 TTAGAGGAGTTCTACATTTAAGG + Intergenic
1054382876 9:64512310-64512332 TTAGAGGAGTTCTACATTTAAGG + Intergenic
1054512857 9:66004044-66004066 TTAGAGGAGTTCTACATTTAAGG - Intergenic
1055159099 9:73102923-73102945 TTCCAGGAACTCTAAATGTAGGG - Intergenic
1192576851 X:72249849-72249871 TTCACTGAACTATACATTTAAGG + Intronic
1195342780 X:103921115-103921137 TCCAAGGAACTCTACATCTTGGG - Intronic
1195829181 X:109036837-109036859 TTAGAGCAACTCTACAGTTATGG + Intergenic
1197042708 X:121958674-121958696 TCCTAGGAAGTCTTCATTTAAGG + Intergenic