ID: 1160148205

View in Genome Browser
Species Human (GRCh38)
Location 18:76380931-76380953
Sequence GCCTTTGCTCACCCGCCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160148205_1160148209 13 Left 1160148205 18:76380931-76380953 CCCAGAGGCGGGTGAGCAAAGGC No data
Right 1160148209 18:76380967-76380989 ACCTCCATGCCGCCACCTGCCGG No data
1160148205_1160148213 22 Left 1160148205 18:76380931-76380953 CCCAGAGGCGGGTGAGCAAAGGC No data
Right 1160148213 18:76380976-76380998 CCGCCACCTGCCGGCTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160148205 Original CRISPR GCCTTTGCTCACCCGCCTCT GGG (reversed) Intronic