ID: 1160148205

View in Genome Browser
Species Human (GRCh38)
Location 18:76380931-76380953
Sequence GCCTTTGCTCACCCGCCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 142}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160148205_1160148213 22 Left 1160148205 18:76380931-76380953 CCCAGAGGCGGGTGAGCAAAGGC 0: 1
1: 0
2: 1
3: 10
4: 142
Right 1160148213 18:76380976-76380998 CCGCCACCTGCCGGCTGCCCAGG 0: 1
1: 0
2: 5
3: 40
4: 362
1160148205_1160148209 13 Left 1160148205 18:76380931-76380953 CCCAGAGGCGGGTGAGCAAAGGC 0: 1
1: 0
2: 1
3: 10
4: 142
Right 1160148209 18:76380967-76380989 ACCTCCATGCCGCCACCTGCCGG 0: 1
1: 0
2: 1
3: 17
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160148205 Original CRISPR GCCTTTGCTCACCCGCCTCT GGG (reversed) Intronic
900211040 1:1456019-1456041 GCCTTTGCCCACCCTCGTGTAGG + Intronic
900223947 1:1524067-1524089 GCCTTTGCCCACCCTCGTGTAGG + Intronic
900472626 1:2862281-2862303 GCCAGTGCTCACCGGGCTCTGGG - Intergenic
900636607 1:3669177-3669199 GGCTTGGCTCGCCCTCCTCTCGG + Intronic
900985869 1:6072581-6072603 GCCTCTGCTCACCCACCCCGGGG - Intronic
902329028 1:15721599-15721621 GCCTTTGCTCAGTGGCCTTTCGG + Intronic
902682184 1:18051200-18051222 GCCCTAGCTCACCCGGCTGTGGG + Intergenic
903275617 1:22219464-22219486 GCCTTTCCTCTTCTGCCTCTGGG + Intergenic
905433330 1:37940448-37940470 CCCTTTGCTCTCCTGGCTCTGGG - Intronic
906380577 1:45329789-45329811 ACCTTTGCTCACACTACTCTTGG + Intronic
909401270 1:75233728-75233750 GCCTTTGGTCTCCTGCCTCATGG - Intronic
910097499 1:83540181-83540203 GCCTTTCCATACCCGACTCTTGG + Intergenic
916902785 1:169247685-169247707 GCCTTTGCATACCCGTATCTTGG + Intronic
918302782 1:183219127-183219149 CCCTCTGCTCAACAGCCTCTGGG - Intronic
919149875 1:193682361-193682383 GCCTTTGTTCTCCGGCATCTTGG + Intergenic
920198687 1:204245911-204245933 GCCTCTGCTCTTCAGCCTCTAGG + Intronic
920963976 1:210687189-210687211 GCCTTTGCTGTACAGCCTCTTGG - Intronic
1069797150 10:71060802-71060824 GCCTTTAATCACCTCCCTCTTGG + Intergenic
1070660104 10:78299443-78299465 GCCATTGCACTCCAGCCTCTGGG + Intergenic
1071604174 10:86973214-86973236 GCCTCTGCTCCCCCGACACTAGG + Intronic
1077009361 11:373342-373364 ACCTGTGCCCACCAGCCTCTTGG + Intronic
1077267029 11:1655956-1655978 GCCATTTCTCACGCGCCTGTCGG + Intergenic
1077378079 11:2214968-2214990 GCCTCTGCTCATCCTCCTCTGGG + Intergenic
1080951602 11:37040039-37040061 ACCTTTCCTCACTCACCTCTAGG + Intergenic
1081612980 11:44574296-44574318 GCCTTTGCTCGCACACCTCAAGG + Intronic
1084363211 11:68682722-68682744 CCCTCTGCTCCTCCGCCTCTCGG + Intergenic
1084849541 11:71927983-71928005 GCCCCAGCTCACACGCCTCTGGG - Intronic
1085018563 11:73191001-73191023 CCCTTTGCTGACCCTTCTCTGGG - Intergenic
1087211847 11:95452989-95453011 GCCTTCGCTCACCCTGCCCTGGG - Intergenic
1088830845 11:113535403-113535425 GCCATTGCACTCCAGCCTCTGGG + Intergenic
1089018601 11:115187825-115187847 GGCTTTGCTAACCCTCATCTAGG - Intronic
1089219399 11:116858371-116858393 GCATTCGCTCACCGGCCACTCGG - Exonic
1090111082 11:123910328-123910350 GCGATTGCTCACCCGCTTTTTGG - Intergenic
1090737768 11:129625872-129625894 ACCTTTGCTCACCCTCTGCTAGG + Intergenic
1091368070 11:135038381-135038403 CCCTTTGCTCACCGGCCTGAGGG - Intergenic
1091457714 12:620123-620145 GCCTGTGCTCTCCCGTCACTAGG - Intronic
1091789569 12:3264144-3264166 CACTTGGCTCACCCGCCTCGAGG + Intronic
1093547490 12:20366365-20366387 GTCTTTGTTCACTTGCCTCTGGG + Intergenic
1096692905 12:53332099-53332121 GCCATAGCTCACCCGCTGCTTGG - Intronic
1097697190 12:62786322-62786344 TCCTTTCCTCTCCCGCCTCAGGG - Intronic
1101598539 12:106188717-106188739 GCGGTTGCCCACCCCCCTCTCGG - Intergenic
1102004714 12:109581784-109581806 ACCTCTGCTCACCCCCATCTTGG + Intronic
1102011462 12:109621812-109621834 ACCTTTGCTCATCAGCTTCTAGG - Intergenic
1108599202 13:51975847-51975869 GCCTTTCCCCTCCCGCCCCTCGG - Intronic
1109282106 13:60368704-60368726 ATCTTGGCTCACCCGCCTCCTGG - Intergenic
1110707330 13:78609786-78609808 GGCTTTGCTCCGCCTCCTCTCGG - Intergenic
1112898917 13:104335883-104335905 CCGTCTGTTCACCCGCCTCTTGG + Intergenic
1113861021 13:113487184-113487206 GGCTTTGCTCACCCTCCCTTGGG - Intronic
1114397038 14:22373338-22373360 GCCTTGGCTCAGTCTCCTCTTGG - Intergenic
1115816763 14:37172117-37172139 TCCTCTGCTCTCGCGCCTCTAGG + Intronic
1118397911 14:65353314-65353336 GCTTTTGCCCTCCAGCCTCTAGG - Intergenic
1118709685 14:68509104-68509126 GCCTGGGCTCACCAGCCACTGGG + Intronic
1125346745 15:38726127-38726149 GCCTTTGCTAATCCTCCTCTAGG - Intergenic
1125452979 15:39828185-39828207 GCATTTTCTCTCCCACCTCTGGG - Intronic
1125611840 15:40976633-40976655 GCCTCTGCTCTCCTGCCACTTGG - Intergenic
1127572594 15:60258895-60258917 GCCTTTGCTAACCCACCTCTTGG - Intergenic
1128840980 15:70851900-70851922 GCCTCTGCACCCCCACCTCTAGG - Intronic
1132782011 16:1632463-1632485 GCATTTTCTCACCAGCCGCTTGG + Intronic
1135437198 16:22437035-22437057 GCCACTGCTAACCCGCCTCCCGG - Intronic
1142011971 16:87720066-87720088 GCTTTGGCTCACCCGGCTGTCGG + Intronic
1142146287 16:88494243-88494265 GCCCCTGCTCGGCCGCCTCTTGG - Intronic
1143858071 17:9867308-9867330 GCATTTGCTGACCAGCATCTGGG + Intronic
1144734286 17:17546319-17546341 GGCTTTGCTCTCCCGTGTCTTGG + Intronic
1149578117 17:57728266-57728288 ACCTTTGCTTACCAGCATCTCGG - Intergenic
1153815325 18:8785704-8785726 CCCTTTGCTCATCCTCATCTTGG + Intronic
1160148205 18:76380931-76380953 GCCTTTGCTCACCCGCCTCTGGG - Intronic
1161484223 19:4525995-4526017 ACATCTGCTCACCCACCTCTGGG + Intronic
1164397126 19:27876156-27876178 GGCTTTTCTCACCTGCCTTTTGG + Intergenic
1165826864 19:38710498-38710520 GCCTTAGCTCACACACCTATTGG + Intronic
1168452532 19:56477439-56477461 GCGTGCGCTCACCCGCCTCTCGG + Intronic
926054863 2:9768554-9768576 CGCTCTGCTCACCTGCCTCTCGG - Intergenic
927484082 2:23477129-23477151 GCCTGTGCTCACCCAGCACTAGG - Intronic
932368198 2:71166518-71166540 GCCTCTGGTCACCCACCTCGAGG - Intergenic
935579386 2:104743693-104743715 GCCTTTTCTCTCCCTCCTCTGGG - Intergenic
936249808 2:110859732-110859754 GTCTTTGCTCACCAGGCGCTTGG + Intronic
937002922 2:118484612-118484634 ACCTCTGCTCACCTGCCTCCCGG + Intergenic
937078540 2:119124511-119124533 GGCTTTGCTCACACCCCTCTTGG - Intergenic
943657844 2:190528372-190528394 GCCTTTGCACAGCCTCCTCGGGG + Intronic
945036623 2:205709049-205709071 GCATTAACTCACCAGCCTCTTGG + Intronic
948135202 2:235631395-235631417 TCCTTGGCTCTCCCGCCTCGTGG - Intronic
1170613788 20:17933686-17933708 CCCTTTGCTCAAGTGCCTCTGGG - Intergenic
1173108359 20:40160243-40160265 GCGTATGCTCTCCAGCCTCTAGG + Intergenic
1173810228 20:45950931-45950953 GCCATTGCACTCCAGCCTCTGGG - Intronic
1174389115 20:50206713-50206735 GCCTTTTCTTTCCCGCCTGTTGG + Intergenic
1176274353 20:64255461-64255483 GCCTTTGCTGACCCACGGCTGGG - Intergenic
1184135226 22:42544859-42544881 GCCCTGGCTCTCCCACCTCTGGG + Intergenic
1184766818 22:46576661-46576683 GCCTTTCCTCGACCGCCTCGCGG - Intronic
1185316814 22:50182915-50182937 GCCTCTGCCCGCCTGCCTCTAGG - Intergenic
952373869 3:32748895-32748917 GTCTTTGCTCACCCACCTCCGGG + Intronic
953676674 3:45007951-45007973 ACCTTTACTCACCCACTTCTAGG - Intronic
954100838 3:48371528-48371550 GCCTTTCCCCACGCCCCTCTAGG + Intergenic
957799904 3:85064128-85064150 GCCTTTGCTAACCTTGCTCTAGG + Intronic
959827353 3:110814437-110814459 GAATTTGCTCAACCGCCTGTGGG - Intergenic
965270093 3:166604072-166604094 GCCATTGCACACCCGCCTGGGGG + Intergenic
966525167 3:180912406-180912428 ACCTTTGTTGACCCGCCCCTAGG - Exonic
968614079 4:1569514-1569536 GCCTTTGCCCACACACCCCTGGG - Intergenic
968986186 4:3875773-3875795 GCCTTTTCTCACCATACTCTGGG - Intergenic
969128067 4:4968850-4968872 GGCTTTGCTCAACCCTCTCTAGG + Intergenic
969173783 4:5384221-5384243 GCCTTTGCCCACACCCTTCTCGG - Intronic
971269157 4:25122570-25122592 GCCTTTGCAAACCTGCCTGTTGG - Exonic
971350562 4:25852241-25852263 GCCTTTGCTCACCCACCAGCTGG - Intronic
971747383 4:30600989-30601011 GCCATTGCTCATATGCCTCTGGG - Intergenic
973095032 4:46186271-46186293 GCCCTTGCTTACCTGCCTCAGGG - Intergenic
974778775 4:66524015-66524037 GACTTTGCTAACCCGTCACTTGG - Intergenic
980088676 4:128418326-128418348 GACTTTTCTCTCCTGCCTCTGGG - Intergenic
980928156 4:139159143-139159165 GACTTTACTCACATGCCTCTTGG - Intronic
988922569 5:35957286-35957308 GCCTTTGCCCACCTCCCTCAAGG - Exonic
988931473 5:36039575-36039597 GCCTTTGCTCACCTACCCCAAGG - Exonic
998406993 5:141879519-141879541 GCCTTTCCTCACCCAGCACTAGG - Intergenic
1001226578 5:169949558-169949580 TGCTGTGCTCCCCCGCCTCTGGG - Intronic
1003002456 6:2348929-2348951 GCCTTTGTTCAACCTCCTCACGG + Intergenic
1003397515 6:5765733-5765755 TCCTTTGCTCAGCCGGCTCCTGG + Intronic
1005089581 6:22042778-22042800 GCCTTTGGACCCCCTCCTCTGGG - Intergenic
1005647571 6:27856077-27856099 CCCTTTGCTCACCCTCCTGGAGG + Intronic
1005732847 6:28715803-28715825 CCCTTTCCTCACCAACCTCTTGG + Intergenic
1007718089 6:43869033-43869055 GCATCTGCTCGCCGGCCTCTGGG - Intergenic
1015346971 6:132171561-132171583 GTTTTTGCTCACTCTCCTCTGGG - Intergenic
1015842487 6:137489512-137489534 CCCTTTTCTCACCCTCCACTGGG - Intergenic
1016581178 6:145630572-145630594 GCCACTGCACACCAGCCTCTGGG + Intronic
1019026093 6:168964196-168964218 GCCTTTCCTGACCCGGCTCCTGG + Intergenic
1022286682 7:28960371-28960393 GCGTCTGCTCACCTTCCTCTAGG - Intergenic
1023209176 7:37784698-37784720 GCCTTGGATCACCTTCCTCTGGG + Intronic
1023427693 7:40056450-40056472 ACATTTGCTCACCCGCCTCAGGG + Intronic
1023794495 7:43780573-43780595 TGCTTTCCTCACCCTCCTCTAGG + Intronic
1023814677 7:43940593-43940615 GCCATTTCACACCCGCCTCATGG + Intronic
1026125908 7:67579301-67579323 GCCATTGCTCCCCAGCCTTTGGG + Intergenic
1027255177 7:76426375-76426397 GCCTGTCCTCTCCCGCCTCAGGG + Intronic
1028909226 7:96189282-96189304 CTCTTTGCTCACCTGCCTCTGGG + Exonic
1028952677 7:96654560-96654582 GCATTTGCTCACCCTCCTGATGG - Intronic
1029623997 7:101708318-101708340 GCCTCTTCACACCCGCCTATGGG - Intergenic
1031922751 7:127613674-127613696 GCCTTTGCCCACAGGCCTCAGGG + Intronic
1032152356 7:129440183-129440205 GCCTTTGTTCAACAGCCACTTGG - Intronic
1032623667 7:133564863-133564885 ACCTTTGCTCACAGGCCTCAAGG - Intronic
1033685693 7:143639639-143639661 GCCTTTTCTCTCCCGCCTTGTGG + Intronic
1033690050 7:143727676-143727698 GCCTTTTCTCTCCCGCCTTGTGG - Intronic
1033698921 7:143817982-143818004 GCCTTTTCTCTCCCGCCTTGTGG - Intergenic
1036236508 8:7043577-7043599 CCCTTTGTCCACCCGCCTGTGGG + Intergenic
1036708520 8:11062251-11062273 GCCTTGGCTCCCAGGCCTCTTGG - Intronic
1037348332 8:17923235-17923257 GCCGTTACTCTCCCGCCTCTGGG - Intronic
1037635637 8:20699228-20699250 TCCCTTGCTCACCTGGCTCTTGG - Intergenic
1039142238 8:34403022-34403044 GCCTTTGCTCATGCTCTTCTGGG - Intergenic
1039429254 8:37512781-37512803 ACCTTTGCTCTCCTGCCTCCTGG + Intergenic
1039846319 8:41328200-41328222 CACTTTGCTCTCCCGCCTCCGGG + Intergenic
1047717538 8:127609580-127609602 GCCTTTGATCAACAGCCTTTAGG - Intergenic
1049416780 8:142499018-142499040 GCCTTTGCTCACCCCTTTCCTGG + Intronic
1056756557 9:89385494-89385516 GCATCTGTTCACCAGCCTCTCGG - Intronic
1058032680 9:100216797-100216819 GTTTTTGCTCACCTTCCTCTGGG - Intronic
1058438033 9:104981915-104981937 TGCTTGCCTCACCCGCCTCTTGG + Intergenic
1060547890 9:124471338-124471360 GCCCTTGCCCACCCACCTTTTGG - Intronic
1062533764 9:137012789-137012811 GCCTGTGACCACCCGCATCTGGG + Exonic
1188953490 X:36406338-36406360 GCCTTTGCTCACACTCCTCCAGG - Intergenic
1191174245 X:57482541-57482563 GCTTCTGCTCACCCTCCTGTGGG + Intronic
1199546972 X:149016782-149016804 GCCTATGTTCACCAGACTCTGGG + Intergenic
1200165382 X:154031814-154031836 TCCTTTGCTCACCCTTCTCATGG + Intronic