ID: 1160150013

View in Genome Browser
Species Human (GRCh38)
Location 18:76391618-76391640
Sequence CCCAGACACGTGACTAGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 69}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160150003_1160150013 15 Left 1160150003 18:76391580-76391602 CCGCAGCCAGGTCCTCCTGCAAA 0: 1
1: 0
2: 3
3: 27
4: 342
Right 1160150013 18:76391618-76391640 CCCAGACACGTGACTAGGACAGG 0: 1
1: 0
2: 1
3: 5
4: 69
1160150002_1160150013 16 Left 1160150002 18:76391579-76391601 CCCGCAGCCAGGTCCTCCTGCAA 0: 1
1: 0
2: 0
3: 29
4: 306
Right 1160150013 18:76391618-76391640 CCCAGACACGTGACTAGGACAGG 0: 1
1: 0
2: 1
3: 5
4: 69
1160150007_1160150013 -8 Left 1160150007 18:76391603-76391625 CCTGCACAGCCCCATCCCAGACA 0: 1
1: 0
2: 1
3: 67
4: 488
Right 1160150013 18:76391618-76391640 CCCAGACACGTGACTAGGACAGG 0: 1
1: 0
2: 1
3: 5
4: 69
1160150004_1160150013 9 Left 1160150004 18:76391586-76391608 CCAGGTCCTCCTGCAAACCTGCA 0: 1
1: 0
2: 2
3: 35
4: 548
Right 1160150013 18:76391618-76391640 CCCAGACACGTGACTAGGACAGG 0: 1
1: 0
2: 1
3: 5
4: 69
1160150005_1160150013 3 Left 1160150005 18:76391592-76391614 CCTCCTGCAAACCTGCACAGCCC 0: 1
1: 0
2: 2
3: 31
4: 365
Right 1160150013 18:76391618-76391640 CCCAGACACGTGACTAGGACAGG 0: 1
1: 0
2: 1
3: 5
4: 69
1160150006_1160150013 0 Left 1160150006 18:76391595-76391617 CCTGCAAACCTGCACAGCCCCAT 0: 1
1: 0
2: 3
3: 20
4: 231
Right 1160150013 18:76391618-76391640 CCCAGACACGTGACTAGGACAGG 0: 1
1: 0
2: 1
3: 5
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160150013 Original CRISPR CCCAGACACGTGACTAGGAC AGG Intronic
900611265 1:3545555-3545577 CCCAGACCCGTGATGAGGAGGGG - Intronic
901632978 1:10656866-10656888 CCCAGGCAAGTGACTGGGCCTGG + Intronic
903839399 1:26227547-26227569 GCCAGACAGGTAACAAGGACAGG + Intergenic
910234855 1:85024890-85024912 CCCAGGCATGTGCCTAGGAAGGG - Intronic
910677847 1:89832824-89832846 TCCAGATTCGTCACTAGGACTGG - Intronic
913530759 1:119732764-119732786 CACAGACAGGTGACTGGGGCTGG - Intronic
915200033 1:154220611-154220633 CCCTGACACGTGACTCAGGCAGG + Intronic
917641590 1:176988153-176988175 CCCAGAAAAGAGATTAGGACTGG + Intronic
1066974373 10:42352974-42352996 TCCAGACAGGTGACCAGGTCTGG + Intergenic
1073182512 10:101593365-101593387 CCCAGAGAAGTGAATTGGACAGG + Intronic
1073324335 10:102633825-102633847 CCCAGACAGGTGAGGAGGGCAGG + Intergenic
1073778608 10:106813074-106813096 CACAGATAAGTGAGTAGGACAGG + Intronic
1075738311 10:124677791-124677813 CCCAGGGACGTGGCTAGGAAGGG + Intronic
1079179076 11:18172855-18172877 GACACACTCGTGACTAGGACTGG - Exonic
1079268342 11:18957393-18957415 GACACACTCGTGACTAGGACTGG + Intergenic
1079906602 11:26255900-26255922 CCCAGAGACTTGACTAGAAAAGG + Intergenic
1087825990 11:102765277-102765299 CCCAGACATGTGATTAGCACTGG + Intergenic
1090398774 11:126435403-126435425 CCCAGAGACATGACTGGGAAAGG - Intronic
1090802243 11:130180162-130180184 CCCAGACCTGAGACAAGGACAGG - Intronic
1093112360 12:15167195-15167217 CCCAGACACTAGACTTGGCCTGG + Intronic
1105229985 13:18484763-18484785 TCCAGACAGGTGACCAGGTCTGG + Intergenic
1108597282 13:51960413-51960435 CCCAGACATGTGACAAAGGCAGG - Intronic
1109896055 13:68692009-68692031 CCAAGACACTTGCCTAAGACAGG - Intergenic
1113080948 13:106519148-106519170 CCCAGACAGATAACTAGGCCAGG + Intronic
1114014241 14:18411579-18411601 TCCAGACAGGTGACCAGGTCTGG + Intergenic
1115364859 14:32546484-32546506 CCAAGTCACGTCACTAGGAATGG + Exonic
1116222756 14:42110559-42110581 CCCAGACATGTGCCTAGGCATGG + Intergenic
1118915325 14:70098137-70098159 CCCTGACATGTGACCAGGACAGG + Intronic
1119377755 14:74208419-74208441 CCCACACATCTGACTAGGCCTGG + Intergenic
1122030027 14:98905368-98905390 CCCAGACCCGGGACTGGGCCAGG + Intergenic
1127616396 15:60690291-60690313 CCAAGACATGTGACCAGGAGGGG + Intronic
1132498339 16:274170-274192 CCCAGACAAGTTCCCAGGACTGG - Intronic
1138050805 16:53775306-53775328 CCAAGACACGTGACTAGGAAAGG - Intronic
1141034711 16:80617193-80617215 TGCATACACGTGACTGGGACTGG - Intronic
1142807459 17:2378986-2379008 CCCAGATATGCGGCTAGGACGGG + Intronic
1151478408 17:74356289-74356311 CCCAGACACAGAACTAGGGCAGG - Intergenic
1152131977 17:78483077-78483099 CCCAGACAGGAGAGGAGGACAGG - Intronic
1154408756 18:14123170-14123192 TCCAGACAGGTGACCAGGTCTGG + Intronic
1154523419 18:15255078-15255100 TCCAGACAGGTGACCAGGTCTGG - Intergenic
1160150013 18:76391618-76391640 CCCAGACACGTGACTAGGACAGG + Intronic
1163125080 19:15240181-15240203 CCCACACAAGTGACTGGGCCTGG + Intronic
1166997461 19:46726561-46726583 ACCAGACACGTGACCATGAAGGG + Intronic
925412523 2:3648114-3648136 CCCAGACTCATCACTAGCACAGG - Intergenic
926167574 2:10531095-10531117 CCCAGATGTGTGACTAGGCCTGG + Intergenic
933509263 2:83218945-83218967 TCCAGACAGGTGACCAGGTCTGG + Intergenic
936324406 2:111492651-111492673 CCCAGACATGTGCTTATGACTGG - Intergenic
938522720 2:132087948-132087970 TCCAGACAGGTGACCAGGTCTGG - Intergenic
940063156 2:149595290-149595312 CCCAGACTCTTGAATAGGATTGG + Intergenic
1169019556 20:2319416-2319438 CCCAGGCAAGTGACTGAGACAGG + Intronic
1170521293 20:17188266-17188288 TCCAGACAGGTGACCAGGTCTGG - Intergenic
1171264963 20:23763701-23763723 CCCAGACATGTGCCTAGGCCTGG - Intergenic
1176773976 21:13113109-13113131 TCCAGACAGGTGACCAGGTCTGG + Intergenic
1180438739 22:15342385-15342407 TCCAGACAGGTGACCAGGTCTGG + Intergenic
1183191894 22:36326884-36326906 CCCTGACAAGTGACCAGGACAGG - Intronic
1183379869 22:37485492-37485514 CCCAGACCCGTGCCCAGGCCAGG - Intronic
955449968 3:59055960-59055982 CCCAAACATGTAACTAGGAATGG + Intergenic
959611304 3:108297953-108297975 CCCAGAGACTTGCCTAGGAGTGG + Intronic
960533777 3:118794415-118794437 CCCAGGCATCTGACTAAGACTGG - Intergenic
965873436 3:173287701-173287723 CCCATACAAGTGAATAGGGCTGG + Intergenic
967613951 3:191542482-191542504 CCCAGGCACGTGAAGGGGACAGG + Intergenic
967700211 3:192583707-192583729 CTCAGACAGGTGTCTAGGAGAGG + Intronic
968377961 4:60075-60097 TCCAGACAGGTGACCAGGTCTGG - Exonic
968406505 4:344352-344374 TCCAGACAGGTGACCAGGTCTGG - Exonic
970889497 4:21026847-21026869 CACACTCACGTGACTATGACTGG - Intronic
993102136 5:83553367-83553389 CCGAGACATGTGACTATGGCTGG + Exonic
1006823666 6:36918098-36918120 CACAGACACGTGACTTTAACAGG - Intronic
1014468015 6:121780473-121780495 ACCAGACAAGTGAGTAAGACAGG - Intergenic
1033835008 7:145299966-145299988 CACTGTCACGTGAATAGGACAGG + Intergenic
1034709239 7:153176276-153176298 CCCAGACACGTGTCAGGGACAGG + Intergenic
1044424762 8:92038279-92038301 GCCAGACACTGTACTAGGACTGG - Intronic
1047026224 8:120827489-120827511 CCCAGAAAAGTGTCTAGTACAGG - Intergenic
1052831153 9:33216926-33216948 CCCAGAGAAGGGACTATGACTGG - Intergenic
1061512645 9:131070266-131070288 CCCAGACACATGACAATGAATGG - Intronic
1203571277 Un_KI270744v1:134172-134194 TCCAGACAGGTGACCAGGTCTGG + Intergenic
1190288550 X:48976414-48976436 CCCAGACAGGTGTCAGGGACTGG + Intronic
1201989138 Y:20005789-20005811 CCGAGACAGGTGATTAGGTCTGG + Intergenic