ID: 1160152538

View in Genome Browser
Species Human (GRCh38)
Location 18:76406109-76406131
Sequence CCTCCGGAGGAGGGGCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 280}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160152538 Original CRISPR CCTCCGGAGGAGGGGCTGCA GGG (reversed) Intronic
900398517 1:2463205-2463227 GCCCCGGAGGGGGAGCTGCAGGG + Intronic
900620774 1:3586740-3586762 CCTGCTGGGAAGGGGCTGCAGGG - Intronic
900637151 1:3671555-3671577 CCTCCAGAGGACGGGCTGCCTGG + Intronic
900676653 1:3891729-3891751 CCTCTGGCGGTGAGGCTGCACGG + Intronic
901413236 1:9099634-9099656 TGACCGGAGGTGGGGCTGCATGG + Intergenic
901615314 1:10534821-10534843 CCTCCCACGGAGGGGTTGCAGGG + Intronic
901833257 1:11906938-11906960 CCAGCAAAGGAGGGGCTGCAGGG + Intergenic
901835791 1:11923202-11923224 CCTCCAGAAGCGTGGCTGCAAGG - Exonic
902275550 1:15337044-15337066 CCTCTGCAGGAGGGGCTGCCAGG + Intronic
902584156 1:17427788-17427810 CCTCCCAAGGAAGGGCTGGAGGG + Intronic
903600280 1:24533157-24533179 CCACCGGGGGAGAGGCTGGAGGG - Exonic
903967618 1:27100242-27100264 CCACCAGAGCAGGGGCTGCTGGG - Exonic
905334989 1:37238965-37238987 CCTCTGGGGGAGGGGGTGCTAGG + Intergenic
906298359 1:44662873-44662895 CCTCAGGAGGAGGGGCAGTTGGG - Intronic
906698119 1:47838388-47838410 TCTCTGGAGGAGGGTCAGCAGGG + Intronic
907497232 1:54853201-54853223 TCACTGGAGGAGGGGGTGCAGGG + Intronic
909282148 1:73770164-73770186 CCTTGGGAGGAGGCTCTGCATGG + Intergenic
914242020 1:145858773-145858795 GCTCCGGGGGCGGGGCTGCGGGG - Intronic
917458294 1:175204771-175204793 CCTCCTGAGGAGCTGCTGGATGG - Intergenic
919838116 1:201590623-201590645 CCAGCTGAGGAAGGGCTGCAGGG + Intergenic
921164065 1:212493632-212493654 CCTACAGTGGAGAGGCTGCAAGG + Intergenic
922273643 1:224056846-224056868 CCTCCTGCAGAGGAGCTGCACGG - Intergenic
922273766 1:224057785-224057807 CCTCCTGCAGAGGAGCTGCACGG + Intergenic
922950976 1:229558433-229558455 CCGCTGGAGGAGCGGCTGCCGGG - Exonic
923006706 1:230055703-230055725 CCTCAGGAGGAGGTGATTCATGG + Intergenic
924064149 1:240207084-240207106 CCTCCTGTGGATGGGCTGCCAGG + Exonic
1063159296 10:3408199-3408221 CCTCAGGAGCAGAGGATGCAGGG + Intergenic
1063333790 10:5189030-5189052 CCTCAAGAGGAGGTGCTGAATGG + Intergenic
1065060616 10:21896964-21896986 CCTCCGGAGGATGTGCAACAAGG + Intronic
1065494501 10:26314849-26314871 CCTCCTGAGCACTGGCTGCAGGG - Intergenic
1065687750 10:28302910-28302932 CCTCCGGGCCCGGGGCTGCAGGG - Intronic
1067225629 10:44374147-44374169 CCTGGGGAGCAGGGTCTGCAGGG - Intronic
1067428850 10:46228804-46228826 TCTCCGCAGGAGTGGCTTCAGGG - Intergenic
1067570340 10:47366914-47366936 CCTCCTGTGGAGGGGATGGATGG + Exonic
1070724626 10:78779608-78779630 CATGGCGAGGAGGGGCTGCAGGG + Intergenic
1071061082 10:81571156-81571178 CCTCAGGAGGAGGCTCTGTATGG - Intergenic
1071334192 10:84588363-84588385 CCTGCTGAGTGGGGGCTGCAGGG - Intergenic
1071718900 10:88123259-88123281 CCTCCTGCAGTGGGGCTGCAGGG + Intergenic
1072788283 10:98299577-98299599 CCTCCAGAGGTGGAGCTGCCAGG - Intergenic
1073046879 10:100644615-100644637 GCTCCAGAGGAGGCTCTGCAGGG + Intergenic
1073123115 10:101133868-101133890 CCCCTGGAGGAGAGGCGGCAGGG + Intronic
1073467757 10:103704267-103704289 CCACTGGAGGAGGAGCAGCATGG + Intronic
1076156680 10:128210582-128210604 CCTCCGGAGGTTGGGCCGCGCGG + Intergenic
1076206323 10:128607257-128607279 CCCCCGGAGGAGAGGAAGCAGGG - Intergenic
1076352416 10:129826139-129826161 GCTCCCCAGGAGGGGCTGCTTGG - Intergenic
1076625553 10:131819511-131819533 CGTGCGGAGGTGGGGCTGCCTGG - Intergenic
1076677155 10:132153102-132153124 TCTCGGGAGGAGGGCCTGCAGGG + Intronic
1076875370 10:133213239-133213261 GCTCCGGTGGAGGGGCTGGGGGG - Intronic
1076886106 10:133263189-133263211 CCTCTGGATGGGGGGCTTCAGGG + Exonic
1077388865 11:2290069-2290091 CCCTCGGGGGAAGGGCTGCAGGG + Intergenic
1077541852 11:3150416-3150438 CCTAAGGAGGAGGAGCTGCTGGG - Intronic
1077918999 11:6629574-6629596 GCCCCTGAGGAGGGGCAGCATGG + Exonic
1078338437 11:10482204-10482226 CCTCCGGAAGAGGGCCTTCCAGG + Exonic
1082657694 11:55872931-55872953 GCTCCGCAGCAGGCGCTGCAGGG + Intergenic
1083340404 11:61955451-61955473 CCTCCCGCGCAGGGGCTCCAGGG - Intronic
1083412623 11:62504781-62504803 CCTCTGGATGCTGGGCTGCAGGG - Intronic
1083535885 11:63466285-63466307 CGTCTGGAGGATGTGCTGCATGG - Exonic
1083746991 11:64742331-64742353 CCTCCGGACGATGGGCGGCTCGG - Intronic
1084197299 11:67530694-67530716 CTTCCGGGGGAGGGGCAGCCAGG + Intergenic
1088915724 11:114226486-114226508 ACTCCAGAGGAGGAGCTGAAAGG + Intronic
1088940751 11:114453454-114453476 CCTCCTGAGGAGTGGTTGGAAGG - Intergenic
1089065119 11:115656766-115656788 CCTCCTGAGCAGTGGCAGCAGGG + Intergenic
1090066251 11:123506221-123506243 TCTTGGGAGGTGGGGCTGCAAGG - Intergenic
1090392875 11:126400781-126400803 GCTCCGGAAGAGGAGCTGGAGGG + Intronic
1090410812 11:126508449-126508471 TCTGAGGAGGAGGGGCTGCCAGG + Intronic
1090915614 11:131159945-131159967 CCTCCAGAGGCATGGCTGCAAGG + Intergenic
1091750347 12:3018332-3018354 CCTGTGGAGGAGGGGCTCCATGG - Intronic
1092052273 12:5480342-5480364 CCTCGGGAGGAGGGGGAGCTGGG + Intronic
1100390124 12:94140594-94140616 CCGGCGGCTGAGGGGCTGCAAGG + Intergenic
1102417565 12:112777571-112777593 CCTCTGAAGTAGGGGCTGAAGGG + Intronic
1103506102 12:121443120-121443142 TCTCCAGAGGAGGGGCTGGAGGG + Intronic
1104034925 12:125091569-125091591 CATCCTGGGCAGGGGCTGCATGG + Intronic
1104508417 12:129354186-129354208 TCTGCTGAGGAGGGCCTGCAAGG - Intronic
1104783926 12:131437815-131437837 CCACTGCAGGTGGGGCTGCAGGG + Intergenic
1104856217 12:131903660-131903682 CCACTGGGGGTGGGGCTGCAGGG - Intronic
1105806042 13:23952078-23952100 CCTTCGGAGGAGCGGATGGAAGG - Intergenic
1106246381 13:27953886-27953908 CCGCCGCAGGAGGGGCTGAGGGG - Intergenic
1107412636 13:40172215-40172237 CCTCCAGAGGGGGAGCTGCGCGG + Intergenic
1109343609 13:61090752-61090774 GCTCTGGAGGAGTGGCTGCCAGG - Intergenic
1109352944 13:61207183-61207205 TCTCTGGAGGAGTGGCTGCCAGG - Intergenic
1113803256 13:113097065-113097087 CCCACAGAGGAGGGGCCGCAGGG + Exonic
1118442110 14:65821531-65821553 CATCCTAAGGAGGTGCTGCAGGG + Intergenic
1121357400 14:93227401-93227423 CCTGCGGAGGAGGTTCTGGAAGG - Exonic
1122736941 14:103848350-103848372 CCTCTGGAGACGGGACTGCAGGG - Intergenic
1122897721 14:104768786-104768808 CGGTGGGAGGAGGGGCTGCAGGG - Intergenic
1123047741 14:105526914-105526936 CCCCGGGAGGAGGGGCGGGAGGG - Intronic
1125477418 15:40056345-40056367 GCTCCGGAGGAGAGGGCGCATGG + Intergenic
1126697908 15:51341452-51341474 CCTGCGGAGGAGGGGCTGGCAGG - Intergenic
1126935321 15:53700685-53700707 TCTCTGGAGGCGGGGATGCAGGG + Intronic
1129175637 15:73837970-73837992 CTTCCTGGGGAGGAGCTGCAAGG - Intergenic
1129297756 15:74609199-74609221 GCCTCTGAGGAGGGGCTGCATGG - Intronic
1132710517 16:1264204-1264226 CTTCTGGAGGAGAGGCTGTAGGG - Intergenic
1132888813 16:2194430-2194452 ACTCTGGAGCAGGGGCTGGAGGG + Intronic
1132971842 16:2693033-2693055 CCTCGGGAGGAGGATCTGCGTGG - Intronic
1133015005 16:2935622-2935644 CCTCCGCCGGAGGGGCAGCCTGG + Intronic
1133317209 16:4892249-4892271 CCTCAGGGGAAGGGGCTGCCTGG - Intronic
1134531657 16:14988843-14988865 CCTCCAGAAGAGTGGCTGCAAGG - Intronic
1138202031 16:55096305-55096327 CATCTGGAGGAGGGGATCCAGGG - Intergenic
1140899932 16:79358117-79358139 CCCCCAGAGGAAGGGCAGCAGGG + Intergenic
1141438905 16:84016690-84016712 CTTCTGGAGGAGGAGCTGCTTGG - Exonic
1141610189 16:85176895-85176917 CCTGGGGAGGAGGGGCAGCCAGG - Intronic
1141722152 16:85762408-85762430 GCTGCGGGGAAGGGGCTGCAGGG + Intergenic
1141731324 16:85824972-85824994 GCTCCGGGGGAGGGGCTGCCTGG + Intergenic
1141797797 16:86286626-86286648 CAGCGGGAGGAGGGGCCGCAGGG + Intergenic
1142196848 16:88742923-88742945 CCTGGGGCTGAGGGGCTGCAAGG + Intronic
1142995126 17:3755451-3755473 CTCCCGGAGGAGGGAGTGCAAGG - Intronic
1144863485 17:18320326-18320348 CCTCCTGAGGAGGAGCTTTATGG + Intronic
1146689739 17:34865159-34865181 ACTCTGGAGGTGGGGCTGCCTGG + Intergenic
1147386889 17:40088265-40088287 CCTCCTGAAGGGGTGCTGCATGG + Exonic
1147393093 17:40122151-40122173 CCTCCTCAGGAGGGGGTGGAGGG - Intergenic
1147771614 17:42872136-42872158 CCTCCCTCTGAGGGGCTGCATGG - Intergenic
1148128074 17:45247056-45247078 ACAGCGGAGGAGGGGCTGCCCGG - Exonic
1148876911 17:50693601-50693623 CCTCCAGAGGAGCAGCTGCAGGG - Exonic
1150248823 17:63694895-63694917 CCTCCAGGGGAGGAGCTACAAGG - Exonic
1150416909 17:64995410-64995432 CCTCCCGAGGAGGGGAGGCAAGG + Intergenic
1150423182 17:65056634-65056656 CCGCCGGAGGAGGAGGTGGAGGG - Exonic
1150659051 17:67059641-67059663 CCTTCAGAGCAGGGCCTGCATGG - Intergenic
1150794759 17:68228515-68228537 CCTCCCAAGGAGGGGAGGCAAGG - Intergenic
1151957627 17:77388279-77388301 CCTCCAGAAGACGGGCTGCCTGG - Intronic
1152392919 17:80013387-80013409 CACCCGCCGGAGGGGCTGCAGGG - Exonic
1152407287 17:80104920-80104942 CCTGCAAAGCAGGGGCTGCAGGG + Intergenic
1152516072 17:80825686-80825708 CGTCAGGAAGAGGGGCTGCGAGG - Intronic
1152576501 17:81143569-81143591 CCACGGGAGGCGGGGCTGCATGG - Intronic
1152657050 17:81524588-81524610 CCTCCGGAGGTGTGGCCACAGGG + Intergenic
1152848891 17:82619776-82619798 CCCCAGGAGTAGGGGCTGCTGGG - Intronic
1158227394 18:55215273-55215295 CCTGCGGAGGAAGGGCTGGGTGG - Intergenic
1158638249 18:59180031-59180053 CCTCCAGAGGAAAGGCTGGAAGG - Intergenic
1160047525 18:75400633-75400655 ACTCTGGAGGAGGGGCAGCGAGG + Intergenic
1160074119 18:75655589-75655611 CCTCTGGAGGAGGAGCGGGAGGG + Intergenic
1160152538 18:76406109-76406131 CCTCCGGAGGAGGGGCTGCAGGG - Intronic
1160773325 19:843550-843572 CCTCCGCAGAAGTGGCTGCCCGG - Exonic
1161194318 19:2977668-2977690 CGGCCGGGGAAGGGGCTGCAGGG + Intronic
1161202692 19:3024831-3024853 CCGCTGGGGCAGGGGCTGCAGGG - Intronic
1162033254 19:7926186-7926208 CCGCGGGGGGCGGGGCTGCAGGG + Intergenic
1163125497 19:15242248-15242270 CCTCCTGATGTGGTGCTGCAGGG - Intronic
1163635985 19:18437458-18437480 CCGCGGGGCGAGGGGCTGCAGGG - Intronic
1164522990 19:28992882-28992904 CCTCCCCAGGAGGCCCTGCATGG + Intergenic
1164576703 19:29409346-29409368 CTGCCGCAGGAGGGGCTGCCCGG + Intergenic
1165745418 19:38227812-38227834 CCTGGGGAGAAGGAGCTGCAGGG - Intronic
1165776145 19:38405378-38405400 GCAGCTGAGGAGGGGCTGCAGGG - Exonic
1166235017 19:41449550-41449572 CCTTGGCTGGAGGGGCTGCAGGG - Intergenic
1166268602 19:41700237-41700259 CCTCCAGGGAGGGGGCTGCAGGG + Intronic
1166268615 19:41700273-41700295 CCTCCAGGGAGGGGGCTGCAGGG + Intronic
1166268628 19:41700309-41700331 CCTCCAGGGAGGGGGCTGCAGGG + Intronic
1166268641 19:41700345-41700367 CCTCCAGGGAGGGGGCTGCAGGG + Intronic
1166268654 19:41700381-41700403 CCTCCAGGGAGGGGGCTGCAGGG + Intronic
1166518617 19:43464714-43464736 CCCCGGGATGAGGGGCTTCATGG - Intronic
1167342020 19:48921946-48921968 TCCAGGGAGGAGGGGCTGCAGGG + Intronic
1168307157 19:55442104-55442126 TCCGAGGAGGAGGGGCTGCAGGG - Intronic
1168315023 19:55481271-55481293 CCGCCGGGGCAGGGGCCGCAGGG - Exonic
924987794 2:287803-287825 CCCCAGGAGGAGGGGGTGCCCGG + Exonic
925317985 2:2939930-2939952 CCTCCGCAGGGCTGGCTGCATGG + Intergenic
926122721 2:10253714-10253736 CCTCGGAAGGAGGAGCTGCTGGG - Intergenic
927809730 2:26174203-26174225 GCCACGGAGGAGGGGCTGCCGGG - Intronic
928115597 2:28543337-28543359 CGTGCTGAGGAGGGGCTGCAGGG + Intronic
928611004 2:32992767-32992789 CCTCAGGAGGAGATCCTGCAGGG + Intronic
930035450 2:47082548-47082570 CGATCGGAGGAAGGGCTGCAAGG + Intronic
933486450 2:82930531-82930553 CCTCCTGAGGAGACACTGCAAGG - Intergenic
934601340 2:95660936-95660958 CCTCCTGAGCACGGACTGCACGG + Intergenic
935229651 2:101084575-101084597 CATCCTGAGGAACGGCTGCATGG - Intronic
936071347 2:109373863-109373885 CTTCCAGAGGAGGGGCTGAGGGG - Intronic
937223779 2:120356753-120356775 CCTCTGGGGGAGGGGCTGCCAGG + Intergenic
937373518 2:121319344-121319366 CCTCTGGAGGAGCTGCTACATGG - Intergenic
938213004 2:129484386-129484408 CCTGAGGAGCAGGGGCTGGATGG - Intergenic
938540353 2:132280037-132280059 GCACCGGCGGAGGTGCTGCATGG + Intergenic
939081988 2:137673684-137673706 CCTCAGGAGGAGGAGCTGAGGGG - Intronic
946837155 2:223783939-223783961 CCACCGGAGGAGGGCCTGTCGGG - Intronic
947716605 2:232342860-232342882 CCACCTGGGGAAGGGCTGCACGG + Intronic
947926936 2:233929608-233929630 CCTGGGGAGGTGGGGCTGCTAGG - Intronic
948096420 2:235337790-235337812 CCTCTGGAGGAGGCACAGCAAGG + Intergenic
1172690032 20:36783902-36783924 CCTCTGGACGTGGGGCTGGATGG - Exonic
1173701566 20:45076422-45076444 CCCCCAAAGAAGGGGCTGCATGG - Exonic
1173719803 20:45246321-45246343 CCTCCCGTGCAGGGGCTGCTGGG + Intergenic
1175830836 20:61964989-61965011 TCCCAGGAGGAGGGACTGCAGGG - Intronic
1176018689 20:62951972-62951994 CCTCCTGGGGAAAGGCTGCATGG + Intergenic
1176027409 20:62993183-62993205 CCTTTGGAGGAAGGGCCGCAGGG + Intergenic
1176181495 20:63751783-63751805 CCACCGGGGGCGGGGCTTCATGG - Intronic
1176301534 21:5101265-5101287 GCTCTGGGGAAGGGGCTGCAAGG + Intergenic
1176310271 21:5145589-5145611 AGTCCGGATGCGGGGCTGCACGG + Intronic
1176428006 21:6560557-6560579 CAGCCCCAGGAGGGGCTGCACGG - Intergenic
1176567863 21:8396373-8396395 CCCTCGGAGGAGGGGCGGCGGGG - Intergenic
1178362224 21:31958182-31958204 CCTCCTGAGGAGGGGAACCATGG - Intronic
1179156976 21:38859285-38859307 CCTCGAGAGGTGGGGTTGCAGGG + Intergenic
1179170594 21:38970081-38970103 CCTCAGGTGGAGAGACTGCATGG - Intergenic
1179703497 21:43168874-43168896 CAGCCCCAGGAGGGGCTGCACGG - Intergenic
1179707984 21:43193622-43193644 CCTCCTGAGGCTGGGCTGCATGG + Intergenic
1179846784 21:44116446-44116468 AGTCCGGATGCGGGGCTGCACGG - Intronic
1179855497 21:44160634-44160656 GCTCTGGGGAAGGGGCTGCAAGG - Intergenic
1179925276 21:44530761-44530783 GCTCCGGGGAAGGGGCTGCAGGG + Intronic
1180000139 21:44991788-44991810 CCTCGGCAGCAGGGGCTCCAGGG + Intergenic
1180025837 21:45161579-45161601 CCTGCCGAGGGGCGGCTGCAAGG - Intronic
1181095323 22:20501151-20501173 ACTCCGGAAGAGGGGCTTCAGGG - Intronic
1181415935 22:22758793-22758815 CCTCCAGGGAAGGGGCTTCAGGG + Intronic
1183469308 22:37997191-37997213 CCTTCAGAGGAGGGGATGGAGGG - Intronic
1184046802 22:41977008-41977030 GCTCCGGGCGCGGGGCTGCAAGG - Exonic
1184113591 22:42409391-42409413 TGTCGGGTGGAGGGGCTGCATGG + Intronic
1184468621 22:44683366-44683388 CCTCAGGAGCTGGGGCTGCCAGG - Intronic
1184859426 22:47164859-47164881 CCTCCTGCGCAGGGGCTGCAGGG - Intronic
1185026646 22:48417862-48417884 CCCCCGGAGGACGGGCTCCCAGG - Intergenic
950030097 3:9846502-9846524 CCAGCGGAAGAGGGGATGCAGGG + Intronic
950181651 3:10917845-10917867 CCTCCGGGGGAGAGGCTTTATGG - Intronic
950206430 3:11084611-11084633 CCTTCGGAGGAGGCACTCCATGG + Intergenic
950471423 3:13188977-13188999 CCTCCTGAGGGGGTGCTGCCAGG - Intergenic
950496002 3:13334994-13335016 CCTGCGGGGCAGGGGCTGCAGGG - Intronic
952887047 3:38018371-38018393 TGCCAGGAGGAGGGGCTGCAGGG - Intronic
952954490 3:38548765-38548787 CGCCCGGTGGAGGGGCTCCATGG + Exonic
953613505 3:44468669-44468691 CCTCGGGGGGAGGGGGTGGAGGG - Intronic
954378025 3:50205168-50205190 CCGCGGGAGGAGGGGCTGGTCGG - Intergenic
954670792 3:52290386-52290408 CCGCCAGAGGAGTGGATGCAAGG - Exonic
954686684 3:52374527-52374549 CTGCCGGAAGAGGGGCTCCATGG - Intronic
954752353 3:52820841-52820863 CCTCCCCAGAAGGGGCTGGATGG - Intronic
954808001 3:53231425-53231447 CCTCCTGTGGAGGGGTTGCCAGG + Exonic
955701685 3:61688030-61688052 CCTCAGAAGAAGGGGCTGAATGG - Intronic
959085731 3:101849398-101849420 CATCCGGAGGAGGGGCTGGGAGG + Intronic
959992887 3:112648092-112648114 CCTGTGGAGGAGGTGATGCAGGG - Intronic
961319214 3:126061390-126061412 CCCCAGGAGGAGGTGTTGCAGGG - Intronic
961404513 3:126668724-126668746 CCTGCGGGGCAGGGGCCGCAGGG + Intergenic
961649978 3:128412471-128412493 CCTCCTGCCAAGGGGCTGCATGG + Intergenic
962475088 3:135748311-135748333 TTTCCAGAGGAGGGGCTGCTGGG - Intergenic
967007694 3:185399852-185399874 CCTCCAGCAGAGGGGGTGCAGGG - Intronic
968456731 4:704191-704213 CCCCCGGGGGAGGGGAGGCAGGG - Intergenic
968522745 4:1041481-1041503 CCTCCGGGGGAGGAGCTGACAGG - Intergenic
969401653 4:6959615-6959637 GTTCCAGAGAAGGGGCTGCATGG - Intronic
969620139 4:8274759-8274781 CAGCCAGAGGAGAGGCTGCATGG - Intronic
972826845 4:42768413-42768435 CCACCGGAGCAGGTGCTACATGG + Intergenic
973231125 4:47839561-47839583 CCTCTGGTGGAGGTGCTACAGGG + Intergenic
973840198 4:54853234-54853256 TCCCCGGAGCAGGGGCTGTAGGG + Intergenic
974110843 4:57523799-57523821 CCTGTGGTGGAGGGGCTGCTGGG - Intergenic
982944828 4:161606983-161607005 CCTCATTAGGAGAGGCTGCAAGG + Intronic
984834957 4:184010838-184010860 CTTCGGGAGGAGTGGCTGAAGGG + Exonic
985693553 5:1326969-1326991 CCTGTGGAGGAGGAGCTGGATGG - Intronic
986314093 5:6574550-6574572 CCGCCAAAGGAGGGGCTGCAAGG + Intergenic
987837372 5:23178963-23178985 CCCCGGGAGGAGGGACTGCCAGG - Intergenic
990967528 5:61465043-61465065 CCTAGAGAGGAAGGGCTGCAGGG + Intronic
991497008 5:67236658-67236680 CCTCAGGAGGACAGGTTGCAGGG + Intergenic
994963424 5:106635151-106635173 CCTCAGTGGGAGGGGCAGCAGGG + Intergenic
997718851 5:136062230-136062252 CTTCAAGAGGAGAGGCTGCAGGG + Intronic
999135111 5:149313546-149313568 CCTTGAGAGGAGGGGCAGCATGG - Intronic
1000052603 5:157575628-157575650 CCGCGGCCGGAGGGGCTGCAGGG + Exonic
1000483599 5:161810614-161810636 CCTCCGGTGCCAGGGCTGCATGG - Intergenic
1001315935 5:170641368-170641390 CCTCAGCATGAGGGGCTGCTCGG + Intronic
1001893904 5:175362504-175362526 CATCCTGAGGAAGGGCTGCATGG + Intergenic
1002280040 5:178124546-178124568 CCTGTTGGGGAGGGGCTGCAGGG - Exonic
1002534580 5:179869260-179869282 GCTCAGCAGGAGTGGCTGCATGG - Intronic
1002582364 5:180216462-180216484 CGTCGGCAGGAGGTGCTGCAGGG + Intergenic
1002717102 5:181234501-181234523 CCGCTGGAGCAGGGGCTGCTGGG - Exonic
1003735871 6:8877020-8877042 CCTGCGCAGGAGGTGCTGCTTGG - Intergenic
1005838210 6:29723612-29723634 CCTCCGGAGGAGGGTCTGGCGGG + Intronic
1006491480 6:34392168-34392190 CCGCCGGAGGAGGGTGTGCCAGG - Intronic
1006920853 6:37626185-37626207 CAGCCTGAGGAGGGCCTGCAGGG - Intergenic
1007473586 6:42105524-42105546 TGGCCAGAGGAGGGGCTGCAGGG - Exonic
1007945433 6:45822573-45822595 TCTCTGGAGGTGGGGCTGGAGGG - Intergenic
1017019733 6:150130573-150130595 GCTCCTGAGGAGAGGCTGCATGG + Intergenic
1017119920 6:151014633-151014655 CCTGCTGAGGACAGGCTGCAGGG - Intronic
1017626669 6:156356382-156356404 CCTCCTCAGGAGGGGCTGCCTGG + Intergenic
1018171959 6:161150712-161150734 CCTCCTGAGGAGTAGCTGCCTGG + Intronic
1018231797 6:161682534-161682556 CCTCCTGTGGAGGGGCTGCGGGG + Intronic
1018420253 6:163634854-163634876 CCTAAGGAGAAAGGGCTGCATGG - Intergenic
1019309715 7:354057-354079 GCTCCAGGGAAGGGGCTGCAGGG + Intergenic
1022096617 7:27145276-27145298 CCTCGGGACGCGGGGCTGCTGGG - Intronic
1022501739 7:30886185-30886207 GCTCGGTAGGTGGGGCTGCAGGG + Intronic
1023089896 7:36608030-36608052 CCTGCAGAGGATGGCCTGCAGGG - Intronic
1025811797 7:64880392-64880414 CCTCCCCAGGAGGGGCTTCCTGG + Intronic
1032087295 7:128890904-128890926 CCGTCGCAGGAGGGGCAGCAAGG + Exonic
1032858809 7:135858810-135858832 CCTCAGGAAGAGGCTCTGCATGG - Intergenic
1033757040 7:144403979-144404001 CCTCCCGTGGCGGGGCTGGAGGG + Intronic
1034270880 7:149802982-149803004 CCCCCGCAGGAGACGCTGCAGGG - Intergenic
1034411627 7:150945281-150945303 CCTCCTGAGCAGGGCCTCCAAGG + Exonic
1034545581 7:151786580-151786602 CCTCGGGCCCAGGGGCTGCATGG + Intronic
1034989221 7:155537246-155537268 CCTCGGAAGGAGAGGCTGGAAGG - Intergenic
1035093051 7:156330513-156330535 CCTCCAGGGCAGGGTCTGCAGGG + Intergenic
1035199116 7:157248800-157248822 GCTCCGCAGGAGGGGCTGCCGGG - Intronic
1037669470 8:21001847-21001869 CCACACGAGGAGGGGGTGCAGGG + Intergenic
1037817576 8:22120211-22120233 CCGCCGGGGCAGGGGCTTCAGGG - Intronic
1039031469 8:33314234-33314256 CCTCAGTTGGAGAGGCTGCAGGG - Intergenic
1040018995 8:42723644-42723666 CCTCTGGAGTAGTGGCTGCATGG + Intronic
1040068635 8:43170655-43170677 GCTGCGGAGGCGGGGCGGCAGGG - Exonic
1040310987 8:46236744-46236766 CCTGGGGAGGGGGGGCTGCTGGG + Intergenic
1045055549 8:98364927-98364949 ACTCCGGAGGAGGGGATGACTGG - Intergenic
1045224336 8:100229849-100229871 CCACAGGTGGAGTGGCTGCAGGG + Intronic
1047944224 8:129858839-129858861 CCTCAACAGGAGGGGCTCCAAGG + Intronic
1049029356 8:140023019-140023041 CTGGAGGAGGAGGGGCTGCACGG + Intronic
1049198123 8:141326474-141326496 CCACCGGGGGTGGGGCGGCAGGG + Intergenic
1049237051 8:141517681-141517703 CCACCTGGGGAGAGGCTGCAGGG - Intronic
1049245025 8:141557800-141557822 CCTGCCGGGGAGGGGCTGCAAGG + Intergenic
1049425534 8:142536407-142536429 ACTCTGTAGGAGGGGCTACAGGG - Intronic
1049583136 8:143421692-143421714 CCTCAGGAGGGTGGGCTGGAGGG + Intronic
1049785814 8:144450166-144450188 CCTCGGAAGGAGGGGAGGCAGGG + Exonic
1051031454 9:12684989-12685011 CCTCCGGAGGAGGACTTGGAAGG - Intergenic
1053487916 9:38474442-38474464 TCTCCAGAGGAGGGAATGCACGG - Intergenic
1053885040 9:42637271-42637293 CCTCAGGAGGAGGGCCTGTCTGG + Intergenic
1054224061 9:62444722-62444744 CCTCAGGAGGAGGGCCTGTCTGG + Intergenic
1055637764 9:78295372-78295394 CCCCGGGAGGAATGGCTGCAGGG + Intergenic
1057128966 9:92640256-92640278 TCTGCGGAGGAGAGGCTGCTGGG - Intronic
1058660386 9:107261321-107261343 CCTCTGGAGGCTGTGCTGCATGG + Intergenic
1059251550 9:112891163-112891185 CCACCGGGGCAGGGGCTGGAAGG + Intergenic
1060475493 9:123983611-123983633 CCTCAGTAGGAGGGGCTTGAGGG - Intergenic
1060772168 9:126340098-126340120 CCTCCGTAGGAGAGATTGCAAGG + Intronic
1060983519 9:127807154-127807176 TCCCCAGAGAAGGGGCTGCATGG + Intronic
1061854362 9:133433468-133433490 CCTCCGCAGGAGCGGGAGCAAGG - Exonic
1061856249 9:133443398-133443420 CCCCCACAGGAGGCGCTGCATGG - Exonic
1062064256 9:134517814-134517836 GCTCTGGGGGAGGGGGTGCAGGG + Intergenic
1062524301 9:136972087-136972109 GTGCCGGAGGAGGGGCTGCAGGG + Intergenic
1062531044 9:137000525-137000547 AATCAGGAGCAGGGGCTGCAGGG - Intergenic
1062540340 9:137039224-137039246 CCTGCGTAGAAGGGTCTGCAGGG + Intergenic
1062624504 9:137436702-137436724 CCTCCGGAGGAGATGCTGGTGGG - Exonic
1062679889 9:137773512-137773534 CCTGCAGAAGAGTGGCTGCAGGG - Intronic
1186478500 X:9877830-9877852 GCTCCGGAGGAGAGGAAGCAGGG + Intronic
1191254242 X:58272952-58272974 CCTCGGGCGCAGGGGCTGCTGGG + Intergenic
1192172879 X:68867719-68867741 CCTCTGGAGGATGGGCTGGTAGG - Intergenic