ID: 1160153547

View in Genome Browser
Species Human (GRCh38)
Location 18:76413634-76413656
Sequence GTGGCAGCCCAGATATTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 130}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160153547_1160153552 -7 Left 1160153547 18:76413634-76413656 CCCCCAAATATCTGGGCTGCCAC 0: 1
1: 0
2: 0
3: 13
4: 130
Right 1160153552 18:76413650-76413672 CTGCCACGGTTTCCTCCCACCGG 0: 1
1: 0
2: 0
3: 9
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160153547 Original CRISPR GTGGCAGCCCAGATATTTGG GGG (reversed) Intronic
902369389 1:15996144-15996166 ATGGCTGCCCAGATATCTGCTGG + Intergenic
902888425 1:19423808-19423830 GTGGCCCCCCAGCTACTTGGAGG - Intronic
909010893 1:70333833-70333855 GTGGGAACCAAGATGTTTGGAGG - Intronic
910100844 1:83574508-83574530 GTGGCATCCAATAGATTTGGAGG - Intergenic
910569645 1:88684818-88684840 GTGGCAGGCCAGGGCTTTGGCGG - Intronic
911099936 1:94087565-94087587 GAGGCAGCACAGGTGTTTGGAGG + Intronic
914336993 1:146724557-146724579 GTGGCAGCACAGCTCATTGGTGG + Intergenic
914940071 1:152014727-152014749 GTGGCAGCCCAGAGGATGGGAGG + Intergenic
917556985 1:176100749-176100771 GTGACACCCCAGATAACTGGTGG - Intronic
1062842800 10:684195-684217 GTGGCAGCACTGATATGTGTGGG - Intronic
1063117040 10:3079031-3079053 GGGGCAGCCCAGCTACATGGGGG + Intronic
1065656060 10:27951476-27951498 GTGGTATCCCAGATTATTGGAGG + Intronic
1067317145 10:45179831-45179853 GTGGCAGGCCGGTTTTTTGGAGG + Intergenic
1067317484 10:45181638-45181660 GTGGCAGGCCGGTTTTTTGGAGG + Intergenic
1067562733 10:47315200-47315222 GAGGCATTCCAGGTATTTGGGGG - Intergenic
1069568592 10:69480184-69480206 GTGGCAGCTCTGGTGTTTGGGGG + Intronic
1073430037 10:103479964-103479986 ATGACAGCCCAGATGTTTGAGGG + Intergenic
1080011506 11:27464254-27464276 TTGGCAGACCAGATATTTTCAGG - Intronic
1080317143 11:30963048-30963070 TTGGTATCTCAGATATTTGGTGG + Intronic
1081041846 11:38223338-38223360 GGTCCAGCCCTGATATTTGGTGG + Intergenic
1081401366 11:42646958-42646980 GTGCCAGCCCAGGTGTTTAGTGG - Intergenic
1083231771 11:61326079-61326101 GTGGTAGCCCTGATAATGGGGGG - Intronic
1083636045 11:64121498-64121520 GTGACACAGCAGATATTTGGGGG - Intronic
1084390649 11:68874647-68874669 ATGGCACCCAAGATATTTGTAGG - Intergenic
1084753991 11:71223055-71223077 GAGGGAGCTCAGAGATTTGGAGG + Intronic
1085387937 11:76167819-76167841 GTGGGAGCCCAGTTATTTACTGG + Intergenic
1089307326 11:117534867-117534889 CTGGCATCCCAGCTCTTTGGAGG - Intronic
1090283226 11:125476126-125476148 GTGGTTGCCCAGAGATTGGGCGG + Intronic
1091632741 12:2174161-2174183 GTGGTATCCCAGATAAATGGTGG + Intronic
1092226604 12:6752373-6752395 ATGGAAGCTCAGATACTTGGAGG + Intronic
1094774172 12:33703683-33703705 GTGGTTGCCCAGATATGTGCAGG + Intergenic
1095837675 12:46655983-46656005 GTAGCATCCCACATATTTGGGGG + Intergenic
1097726896 12:63085746-63085768 GTATTAACCCAGATATTTGGTGG - Intergenic
1097790156 12:63806962-63806984 GTGGAAGCCCAGATTATTGGAGG - Intronic
1098992308 12:77077246-77077268 GGGGCCACACAGATATTTGGTGG - Intergenic
1100783327 12:98052645-98052667 GTGTAAGCCCAGATATGTGTGGG - Intergenic
1104495381 12:129232125-129232147 GTTGCAGCCCGGATCTTGGGAGG + Intronic
1105637917 13:22233681-22233703 TTGGCAGGCCAAATATTTGGGGG - Intergenic
1110151441 13:72259615-72259637 GTGTAAGACCAGATACTTGGAGG + Intergenic
1111540437 13:89661088-89661110 CTAGCATCCCAAATATTTGGAGG + Intergenic
1113662312 13:112116078-112116100 GTCGCGTCCCAGACATTTGGAGG + Intergenic
1118989837 14:70787862-70787884 GTAGCAGCCCAGGTGTTTGGTGG - Intronic
1119121705 14:72085462-72085484 GTCCCAGCCCAGAGATTTGTTGG + Intronic
1121439542 14:93940072-93940094 TTGCCAGCTCAGTTATTTGGAGG + Intronic
1122347558 14:101069996-101070018 GGAGCAGCCCTGACATTTGGGGG - Intergenic
1126800083 15:52290096-52290118 GAGGCAGCCTAGATACCTGGGGG - Intronic
1129412074 15:75355702-75355724 ATGGCTTCCCAGGTATTTGGTGG - Exonic
1129454917 15:75671581-75671603 GTGGCCACCAAGATAATTGGTGG - Intergenic
1132543179 16:520984-521006 TTGGCAGCCCCGGTCTTTGGCGG - Exonic
1135891417 16:26360689-26360711 GTGGCTGCAAACATATTTGGAGG - Intergenic
1137576706 16:49604801-49604823 GTGGCAGCCCAGGAATGGGGTGG - Intronic
1139997276 16:70992762-70992784 GTGGCAGCACAGCTCATTGGTGG - Intronic
1143618977 17:8070438-8070460 GTGGGAGGCCAGATATTAAGAGG - Intergenic
1144403079 17:14925598-14925620 GTGGAAGAGCTGATATTTGGAGG + Intergenic
1144457900 17:15433824-15433846 TGGGCAAGCCAGATATTTGGGGG - Intergenic
1144689654 17:17252310-17252332 CTGGCAGTCCTGACATTTGGGGG + Intronic
1146787627 17:35732736-35732758 GTGGCAGCTCAGAGATTTCTAGG - Intronic
1149309535 17:55380635-55380657 GCGGCAGCCCAGATAGATGTTGG + Intergenic
1153504965 18:5787664-5787686 GTGGCACCCCATAAATTTGTGGG - Intergenic
1155386717 18:25285842-25285864 GTGGCAGTCCTGATACATGGAGG - Intronic
1155812146 18:30250310-30250332 GAGGCATGCCAAATATTTGGTGG + Intergenic
1157434074 18:47653813-47653835 TTGGCTGTCCAGATAATTGGGGG + Intergenic
1159221385 18:65468564-65468586 CTGGCAGTCCAGAAAATTGGAGG - Intergenic
1160153547 18:76413634-76413656 GTGGCAGCCCAGATATTTGGGGG - Intronic
1163658417 19:18561851-18561873 GTGCCACCCCAGGAATTTGGAGG - Intronic
1165221203 19:34317995-34318017 GTGGAAGCCCAGGAGTTTGGGGG + Intronic
1165815139 19:38637210-38637232 GTGGCAGCCCAGCCCTGTGGTGG + Intergenic
1167371596 19:49085778-49085800 GTGGGTGCCCAGAGATTTCGGGG - Intronic
929064151 2:37956177-37956199 GTGAAAGCCCAAATATTTGGTGG - Intronic
932096106 2:68850303-68850325 CTGGCACACCAGAAATTTGGAGG - Intergenic
932628678 2:73319705-73319727 TAGGCATCCCAGATATATGGTGG + Intergenic
936015292 2:108954299-108954321 ATGGCAGCCCATATATCTTGGGG - Intronic
937551468 2:123097592-123097614 GTGGCTGCCAAGACATTTAGGGG + Intergenic
944873118 2:203933945-203933967 GGTGAAGCCTAGATATTTGGGGG + Intergenic
1169415904 20:5416029-5416051 GTTGCAGCCCAGATCCTTGGAGG - Intergenic
1169460727 20:5792540-5792562 GTGTAATCCCAGCTATTTGGGGG - Intronic
1170909269 20:20548010-20548032 GTGGCAGACCACATATATGATGG - Intronic
1172328296 20:34054701-34054723 CTGGCATCCCAGCTACTTGGGGG + Intronic
1178263748 21:31123713-31123735 GAGGCAGCCCAGAATTTTGCAGG - Intronic
1179167587 21:38946828-38946850 GTGGAAGCCCATATATCTTGGGG + Intergenic
1181857915 22:25795696-25795718 GTGGCGGCCCAGAAATATGATGG + Intronic
1184769525 22:46589300-46589322 GGGGCAGCTCTGATATGTGGGGG + Intronic
1184769537 22:46589336-46589358 GGGGCAGCTCTGATATGTGGGGG + Intronic
949447894 3:4154804-4154826 GTGGTTGCCCAGATATTGGCTGG - Intronic
951314433 3:21171299-21171321 GTGGGACCCCAAATCTTTGGTGG - Intergenic
952181067 3:30917315-30917337 GTGGAACACAAGATATTTGGGGG - Intergenic
955806607 3:62742477-62742499 GTGGAAGATCAGATATTTGTAGG - Intronic
955919382 3:63939537-63939559 ATGGCAGAGCAGATTTTTGGAGG - Intronic
956844822 3:73172946-73172968 ATGGGAGACCAGGTATTTGGTGG - Intergenic
956854161 3:73259529-73259551 GAGGCAGTGCAGATTTTTGGAGG - Intergenic
956933417 3:74072223-74072245 GGTGTAGCCCAGAAATTTGGAGG + Intergenic
962090815 3:132242350-132242372 GTGGCATCCCAGACAGTGGGTGG + Intronic
963278262 3:143354599-143354621 GTAGGAGCCAAGATATTTGCAGG - Intronic
964201305 3:154121752-154121774 GCGGCAGCCCAGATTTCTGCCGG + Intronic
967413418 3:189190489-189190511 GAGGCTGCCCAGAGATTTGAGGG - Intronic
971254763 4:25004193-25004215 GTGGTAGCCCAGCTCTTCGGTGG - Exonic
972044485 4:34647475-34647497 GTGGAATGTCAGATATTTGGTGG + Intergenic
974903154 4:68025703-68025725 GTCACAGCCCAGATACTTGGTGG - Intergenic
979103327 4:116651147-116651169 GTGGCAGCTCTGATATCTTGGGG + Intergenic
979217448 4:118182461-118182483 GAGGCATCCCAGATTTTTTGTGG - Intronic
983167981 4:164500623-164500645 CTAACAGCCCAGTTATTTGGAGG - Intergenic
989716462 5:44468647-44468669 CTGACAGCTCAGATATTTGTGGG + Intergenic
990468419 5:56090790-56090812 GTGGCAGCCCACCTCTCTGGGGG + Intergenic
991479827 5:67065937-67065959 GTGGCAACCCAGAAGTTTAGAGG + Intronic
994311811 5:98281453-98281475 ATGTCAGACCAGATATTTTGAGG - Intergenic
997281625 5:132651858-132651880 GTGGCCATGCAGATATTTGGGGG - Intergenic
997644852 5:135474780-135474802 GGGTCAGCCCAGAAAATTGGGGG + Intergenic
1003302999 6:4901935-4901957 GTGGCAGCCCAGAGCTGCGGGGG - Intronic
1004933351 6:20483303-20483325 TTGGCTTCCCAGATTTTTGGTGG + Intronic
1007238173 6:40405977-40405999 GTCGCAGCCCAAGTGTTTGGTGG + Intronic
1009628239 6:66163767-66163789 GGTCCAGCCCTGATATTTGGTGG + Intergenic
1014048729 6:116926552-116926574 CTGGCGGCCCAGAGAGTTGGTGG + Intronic
1019344092 7:521179-521201 GTCGCTCCCCAAATATTTGGGGG - Intergenic
1019643421 7:2116550-2116572 GTGGCAGGCCAGAGGGTTGGGGG + Intronic
1019812619 7:3175602-3175624 GAGGCTGCCCAGATAATTGGAGG + Intergenic
1019903202 7:4040720-4040742 GTGGGTGGCCAGATTTTTGGAGG - Intronic
1021214235 7:17896541-17896563 TTGAGACCCCAGATATTTGGAGG - Intronic
1022561200 7:31351701-31351723 GAGGCAGCACATATATTTGGTGG + Intergenic
1026297049 7:69062196-69062218 CAGGCTGCCCAGATATTTGGTGG - Intergenic
1026887915 7:73965221-73965243 GAGGCTGCCCAGAGATTAGGAGG + Intergenic
1028280958 7:88927009-88927031 GTGGCAGCGCATACATTTTGGGG + Intronic
1028677186 7:93478802-93478824 GTGACTGCCCAGATATTTTCAGG - Intronic
1032547304 7:132754660-132754682 GTGGGAGCCCATATAGTTGATGG - Intergenic
1035641617 8:1188874-1188896 GTGGCATCATATATATTTGGAGG - Intergenic
1037658651 8:20908539-20908561 GTGGGAGCACAAGTATTTGGTGG + Intergenic
1038269591 8:26064427-26064449 GTGACAATTCAGATATTTGGAGG - Intergenic
1041605674 8:59780021-59780043 GTGGCATCTCAGAAATTTGTGGG + Intergenic
1046418091 8:113941400-113941422 GTGCCAGCCCAGATTAATGGTGG + Intergenic
1047740771 8:127804660-127804682 GTGGCATCCCAGCTACTCGGAGG - Intergenic
1050423430 9:5490428-5490450 GTGGGAGGGCAAATATTTGGAGG - Intergenic
1051826643 9:21229042-21229064 ATGGCAGCCCAAATATATGCAGG + Intronic
1054762072 9:69012870-69012892 CAGGAAGCCCAGATATTTGGAGG - Exonic
1055366557 9:75550460-75550482 GTGGCAGGGCAGATCTGTGGAGG - Intergenic
1057706029 9:97395831-97395853 GTGGCAGCCCAGATTTCTGCGGG + Intergenic
1058114678 9:101071306-101071328 GAGGAAGAACAGATATTTGGAGG + Intronic
1185908335 X:3958767-3958789 GTTGGAGCCCAGATATTAGCAGG - Intergenic
1186294729 X:8136573-8136595 GTGACAGACCACATATTTGATGG + Intergenic
1190249443 X:48711005-48711027 GTGCCAGCTCAGTTGTTTGGGGG - Intergenic
1191864858 X:65695751-65695773 GTGCCAGCTCATAGATTTGGGGG - Intronic
1195405000 X:104503107-104503129 GTGGCTGCACAGATATTTAGCGG + Intergenic
1196190618 X:112790647-112790669 GTGGGAGCAGAAATATTTGGAGG - Exonic
1197784525 X:130187010-130187032 GTGGGAGCCCAGCCCTTTGGGGG - Intergenic
1198439221 X:136645778-136645800 GTGGCAACCAAGGTTTTTGGAGG + Intergenic
1199365215 X:146972402-146972424 GAGACAATCCAGATATTTGGAGG - Intergenic