ID: 1160153552

View in Genome Browser
Species Human (GRCh38)
Location 18:76413650-76413672
Sequence CTGCCACGGTTTCCTCCCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 164}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160153542_1160153552 5 Left 1160153542 18:76413622-76413644 CCTTAACGCCCACCCCCAAATAT 0: 1
1: 0
2: 1
3: 22
4: 247
Right 1160153552 18:76413650-76413672 CTGCCACGGTTTCCTCCCACCGG 0: 1
1: 0
2: 0
3: 9
4: 164
1160153541_1160153552 15 Left 1160153541 18:76413612-76413634 CCTCAGCACACCTTAACGCCCAC 0: 1
1: 0
2: 0
3: 12
4: 104
Right 1160153552 18:76413650-76413672 CTGCCACGGTTTCCTCCCACCGG 0: 1
1: 0
2: 0
3: 9
4: 164
1160153539_1160153552 25 Left 1160153539 18:76413602-76413624 CCCTCGAATACCTCAGCACACCT 0: 1
1: 0
2: 0
3: 8
4: 73
Right 1160153552 18:76413650-76413672 CTGCCACGGTTTCCTCCCACCGG 0: 1
1: 0
2: 0
3: 9
4: 164
1160153547_1160153552 -7 Left 1160153547 18:76413634-76413656 CCCCCAAATATCTGGGCTGCCAC 0: 1
1: 0
2: 0
3: 13
4: 130
Right 1160153552 18:76413650-76413672 CTGCCACGGTTTCCTCCCACCGG 0: 1
1: 0
2: 0
3: 9
4: 164
1160153551_1160153552 -10 Left 1160153551 18:76413637-76413659 CCAAATATCTGGGCTGCCACGGT 0: 1
1: 0
2: 0
3: 6
4: 92
Right 1160153552 18:76413650-76413672 CTGCCACGGTTTCCTCCCACCGG 0: 1
1: 0
2: 0
3: 9
4: 164
1160153546_1160153552 -4 Left 1160153546 18:76413631-76413653 CCACCCCCAAATATCTGGGCTGC 0: 1
1: 0
2: 1
3: 13
4: 171
Right 1160153552 18:76413650-76413672 CTGCCACGGTTTCCTCCCACCGG 0: 1
1: 0
2: 0
3: 9
4: 164
1160153538_1160153552 26 Left 1160153538 18:76413601-76413623 CCCCTCGAATACCTCAGCACACC 0: 1
1: 0
2: 1
3: 2
4: 61
Right 1160153552 18:76413650-76413672 CTGCCACGGTTTCCTCCCACCGG 0: 1
1: 0
2: 0
3: 9
4: 164
1160153545_1160153552 -3 Left 1160153545 18:76413630-76413652 CCCACCCCCAAATATCTGGGCTG 0: 1
1: 0
2: 2
3: 12
4: 167
Right 1160153552 18:76413650-76413672 CTGCCACGGTTTCCTCCCACCGG 0: 1
1: 0
2: 0
3: 9
4: 164
1160153549_1160153552 -9 Left 1160153549 18:76413636-76413658 CCCAAATATCTGGGCTGCCACGG 0: 1
1: 0
2: 0
3: 7
4: 72
Right 1160153552 18:76413650-76413672 CTGCCACGGTTTCCTCCCACCGG 0: 1
1: 0
2: 0
3: 9
4: 164
1160153540_1160153552 24 Left 1160153540 18:76413603-76413625 CCTCGAATACCTCAGCACACCTT 0: 1
1: 0
2: 0
3: 1
4: 85
Right 1160153552 18:76413650-76413672 CTGCCACGGTTTCCTCCCACCGG 0: 1
1: 0
2: 0
3: 9
4: 164
1160153548_1160153552 -8 Left 1160153548 18:76413635-76413657 CCCCAAATATCTGGGCTGCCACG 0: 1
1: 0
2: 0
3: 5
4: 92
Right 1160153552 18:76413650-76413672 CTGCCACGGTTTCCTCCCACCGG 0: 1
1: 0
2: 0
3: 9
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160153552 Original CRISPR CTGCCACGGTTTCCTCCCAC CGG Intronic
900394449 1:2447444-2447466 CTCCCAGGGTGCCCTCCCACTGG + Intronic
900707039 1:4087250-4087272 CTGCCAGGTTAACCTCCCACAGG - Intergenic
902632391 1:17712890-17712912 CTGGCACGGTGTCATCCCATGGG - Intergenic
905946737 1:41907565-41907587 CTGGCACGGTTCCCTCCCCTGGG + Intronic
906431046 1:45756014-45756036 CTTCCACCCTTTCCTCCCTCAGG - Intergenic
906560191 1:46750866-46750888 CTGCGATGGAGTCCTCCCACAGG - Intergenic
907144444 1:52219616-52219638 CTTCCACCCTTTCCTCCCTCAGG - Intronic
907289693 1:53405717-53405739 CTGCAACTATTTCCTTCCACAGG - Intergenic
907639432 1:56171258-56171280 CTGCTGCTGTTACCTCCCACCGG + Intergenic
914802948 1:150974112-150974134 CTGCCCCGTTTTCTTCCTACCGG - Intronic
914909818 1:151775819-151775841 CTGGCACGGATTGCTCCCTCAGG - Exonic
920189587 1:204184616-204184638 CTTCCATGGTTTCATCCCAAGGG + Intergenic
921146972 1:212367502-212367524 CAGACTTGGTTTCCTCCCACTGG - Intronic
923479654 1:234371902-234371924 CTGCTTCAGTTTCATCCCACAGG + Intergenic
923766379 1:236895830-236895852 CTGCCCCAGTTTCCTGTCACAGG + Intronic
924455830 1:244218251-244218273 CTGCCAAGGGTTCCTCCTTCAGG - Intergenic
1062915786 10:1240563-1240585 CTGCCCCGGCTGCCTCCCCCAGG + Intronic
1064136927 10:12758970-12758992 CTGCCTCGATTGCATCCCACTGG + Intronic
1068446617 10:57133338-57133360 CTGCCAAGGTTTCTACCCTCTGG + Intergenic
1069464389 10:68625370-68625392 CTGCCAAGGCTTCATCACACAGG + Intronic
1069550138 10:69358395-69358417 CTGCTATGGTTACCTCCCTCGGG - Intronic
1072697522 10:97614905-97614927 CTGACACAGTTTCTTCCCAGTGG - Exonic
1074689660 10:115992708-115992730 CTGACCCGGTGTCCTCCCCCAGG + Intergenic
1076625734 10:131820672-131820694 CTGCCTCATTTTCCACCCACAGG + Intergenic
1076696765 10:132250959-132250981 CCGCCACTGTACCCTCCCACTGG - Intronic
1077367064 11:2165571-2165593 AGGCCTCAGTTTCCTCCCACTGG + Intronic
1080464647 11:32485413-32485435 CTGCCAGTGTTTCCTCCACCTGG - Intergenic
1081407390 11:42713875-42713897 CTGCCTTGGTTTCCTCCCTTGGG - Intergenic
1083194099 11:61072698-61072720 CTACCAGGGTTCCCGCCCACTGG - Intergenic
1083195236 11:61082110-61082132 CTGCCAAGGCTTCCTCCCCCAGG - Intergenic
1083681921 11:64355240-64355262 CTGCCAAGGTCTCATCCCGCAGG - Exonic
1089094339 11:115906391-115906413 CTGCCACTGTTTTCCCCCAAGGG - Intergenic
1092397806 12:8143869-8143891 CTGCCACAGGTTAGTCCCACAGG - Intronic
1094253835 12:28399353-28399375 CCACCATGATTTCCTCCCACTGG + Intronic
1097233445 12:57525565-57525587 CAGCCCCCGTTTCCTCCCAAGGG + Exonic
1102532104 12:113554161-113554183 CTCCAACGGTGCCCTCCCACTGG - Intergenic
1104073413 12:125368567-125368589 CTTCCACTGCTGCCTCCCACTGG - Intronic
1105589375 13:21776818-21776840 CTGCATGGGTTTCCTCCCGCAGG + Intergenic
1105793734 13:23830424-23830446 CTGCCCCGCTTGCCTCCCAGAGG - Intronic
1107558933 13:41543504-41543526 CTGCCACAGTTCCATGCCACCGG + Intergenic
1108234750 13:48391862-48391884 CTGCCTCGGCCTCCTCCCAAAGG + Intronic
1114699416 14:24662264-24662286 CTGCCCTGGTTTCCTCACAATGG - Intergenic
1121119715 14:91369023-91369045 CTGCGGCTGTTCCCTCCCACTGG - Intronic
1121639054 14:95473157-95473179 CTGCCAGTGTCTCCTCCCACGGG - Intronic
1122208457 14:100159906-100159928 CTGCCACCGCGGCCTCCCACCGG + Exonic
1122773152 14:104106043-104106065 GTGCCTCGGTTTCCCCCTACAGG + Intronic
1122979339 14:105184641-105184663 CAGCCACGGTGACCTCCCAGAGG - Intergenic
1124171107 15:27374813-27374835 CTCCTACAGTTTCCGCCCACTGG - Intronic
1128247134 15:66140753-66140775 CTGCCAGGCTGGCCTCCCACCGG - Intronic
1128647520 15:69388200-69388222 CTTCCAGGGGTTCCTCCCTCAGG + Intronic
1128955085 15:71932376-71932398 CTGCCACTGCTCCCTCCCAAGGG - Intronic
1129619996 15:77135632-77135654 CTGACTCAGTTACCTCCCACTGG - Intronic
1132570858 16:643270-643292 GTGCCTCGGTTTCCTCCCCTGGG - Intronic
1132839073 16:1969583-1969605 GTGGCACGGTTTCCGCTCACTGG - Intergenic
1136994157 16:35176743-35176765 CACCCACGTTTTTCTCCCACAGG - Intergenic
1137780677 16:51095452-51095474 CTGCCACGGACCCCTCCCCCAGG - Intergenic
1138428940 16:56955380-56955402 CTGCCACAGATTCCTCTCTCTGG + Intergenic
1140467772 16:75196166-75196188 CTGCCCCTGTGTGCTCCCACAGG - Intergenic
1141424223 16:83934960-83934982 GGGCCACGGTCTCCTCCCTCTGG - Intronic
1143373625 17:6455105-6455127 CAGCCACTGCTGCCTCCCACGGG - Exonic
1144782491 17:17815047-17815069 GTGCCACTGTCTCCTCCCACAGG + Intronic
1145289584 17:21532824-21532846 CTGCCACGGTTTCCCCAGGCAGG - Exonic
1146789514 17:35743417-35743439 CTCCCAGGGTTTCCCACCACAGG + Exonic
1149655907 17:58309503-58309525 CTCCCACGGCTTCCTCCGAGAGG + Intronic
1151719119 17:75845595-75845617 CTGGGACGGTTCCCTCCCATGGG - Intergenic
1155849851 18:30760069-30760091 CTGACAAGGTTTCCTTCAACTGG + Intergenic
1156482375 18:37444390-37444412 CTCCCACGGTTGCCTCTCTCAGG - Intronic
1157674700 18:49560732-49560754 CCGGCTCGGTTTCCTCGCACAGG + Intronic
1158609781 18:58928603-58928625 CTGCCACTGTCTCCTCCAAGGGG - Intronic
1160153552 18:76413650-76413672 CTGCCACGGTTTCCTCCCACCGG + Intronic
1160713171 19:562661-562683 CTTCCACCCTTTCCTCCCTCCGG - Intergenic
1162467769 19:10852790-10852812 CTGCCAGGGTTCCCTCACTCAGG - Intronic
1164596960 19:29536579-29536601 GTGCCACGCTCTCCTCTCACCGG + Intronic
1164848722 19:31461188-31461210 TTCCCACAGTTTTCTCCCACTGG + Intergenic
1165064021 19:33218841-33218863 CTGCCCTGGGTTCCTCCCAGTGG + Intronic
924998556 2:385935-385957 CTGCTCCCCTTTCCTCCCACAGG + Intergenic
926354017 2:12023245-12023267 CTGCCTCAATTACCTCCCACTGG - Intergenic
927579220 2:24226326-24226348 CTGCCAGAGTTTCCTCTCATTGG - Intronic
928092013 2:28380449-28380471 CTTCCCTGGCTTCCTCCCACAGG - Intergenic
930238007 2:48906168-48906190 TTGGCAAGGTTGCCTCCCACTGG - Intergenic
933800884 2:85959523-85959545 CTTCCACGGTCTGGTCCCACTGG - Intergenic
936661071 2:114544311-114544333 ATGTCTTGGTTTCCTCCCACAGG - Intronic
940748439 2:157597142-157597164 CTGCCGCGGTTTCCTCAGGCTGG - Intronic
946231067 2:218291672-218291694 CTCCCTCTGCTTCCTCCCACTGG + Intronic
947674035 2:231961505-231961527 CTGCAACGGTTGGCTCCCAGTGG - Intronic
1169163971 20:3407215-3407237 CTGCAACGGTTTCCCCACAATGG - Intronic
1172123283 20:32610923-32610945 GTGCCACTGTGTCCTCCCCCAGG + Intergenic
1173933381 20:46840264-46840286 CAGCCACGGTTTCCTGTCCCAGG + Intergenic
1174106824 20:48168268-48168290 ATCCCACGGTTCCCTCCCCCAGG + Intergenic
1174933262 20:54839379-54839401 GTGCCAAGGCTTCCTCCCCCTGG - Intergenic
1175166671 20:57048914-57048936 CAGCCACGGGTTCCAGCCACAGG - Intergenic
1175174674 20:57104075-57104097 CTGCCAGGGTTTTCTACCTCGGG - Intergenic
1176159961 20:63642807-63642829 CTGCCCCGCTCTCCTCCCAGGGG - Intronic
1179637771 21:42724406-42724428 TGGCCACAGTTTCCTCCCAGGGG - Intronic
1179819794 21:43930193-43930215 CTTCCACGGTTCCCTGCCCCCGG + Intronic
1180214071 21:46313789-46313811 CTGCCAGGGTCCCCTCCCAAAGG + Intronic
1182325819 22:29511957-29511979 CTGCCACGGCCACCTCCCCCGGG + Intronic
1183977878 22:41523680-41523702 CTGCCAGGGTTGCCTCCTCCTGG - Intronic
1184273971 22:43399907-43399929 CTCCCAGGGCTTCCTCCCCCAGG + Intergenic
1184823819 22:46933489-46933511 CTGCCTCGTTTCCCTCCCACTGG - Intronic
949822114 3:8126700-8126722 CTGCCATTGGTTTCTCCCACTGG - Intergenic
950601806 3:14041628-14041650 CTTCCACCCTTTCCTCCCTCAGG - Intronic
950946184 3:16949250-16949272 CTGCCAGGTTATCCTCTCACAGG + Intronic
953197742 3:40750275-40750297 CTGCCACTGTTACCCCACACGGG - Intergenic
954444554 3:50539741-50539763 CTTCCTGGGTTTCCACCCACAGG - Intergenic
954605849 3:51908686-51908708 CTGCCACCATTCCCTCCCATGGG + Intergenic
955318730 3:57959337-57959359 CTCCCACGGTGGCCTCCCAGCGG - Intergenic
956138474 3:66121890-66121912 CTGCAGCGGTTTCCACTCACAGG + Intergenic
966650173 3:182291799-182291821 CTGCCACTTTCTCTTCCCACTGG + Intergenic
966909740 3:184552442-184552464 CTGCCACCGCTTCCTCCTCCTGG - Intronic
967109271 3:186279224-186279246 CTTCCAAGGTTTCTTCCCACTGG + Intronic
967736395 3:192957194-192957216 CTGCATCGGTTTCCTCTAACTGG - Intergenic
977654798 4:99508353-99508375 CTGCCAAGATTTCCTCCCCATGG - Intergenic
977854413 4:101872217-101872239 ATGCCATGGTTTGCTGCCACTGG - Intronic
983098134 4:163590186-163590208 TTGCCAAGGTTTCCTGGCACTGG + Intronic
984840866 4:184066072-184066094 CTGCCAGGGTTTCCTGGGACTGG - Intergenic
985671833 5:1210783-1210805 CTCCCACGCTTTCCTCCCAAGGG - Intronic
988669055 5:33361430-33361452 CCTCCACGATTACCTCCCACCGG + Intergenic
989002007 5:36771010-36771032 ATGATTCGGTTTCCTCCCACTGG + Intergenic
989612434 5:43307800-43307822 CTGTCACTGTTTCCTCCTTCGGG + Exonic
991212269 5:64119207-64119229 ATGCCACGGTGTTCTTCCACTGG + Intergenic
992838154 5:80660393-80660415 CTCCCACTGGGTCCTCCCACTGG + Intronic
995408768 5:111831578-111831600 CTACCACTCTTTCCTCCCACCGG + Intronic
996726369 5:126676174-126676196 CTGCCTCAGTTTCTGCCCACCGG + Intergenic
999785026 5:154883133-154883155 CTTCCACCCTTTCCTCCCTCAGG + Intergenic
999923079 5:156343993-156344015 CTGCCACGGTTGCCACTGACTGG + Intronic
1001854985 5:175003266-175003288 CTGCCAGGGTTTCGCTCCACTGG + Intergenic
1002184221 5:177446839-177446861 CTGCCACTGTCTGCTCCCCCGGG + Exonic
1002573937 5:180161092-180161114 CTGCCACCACTTCCTCCCCCAGG - Intronic
1004373989 6:15076092-15076114 CTCCCACTGTTTCCTGTCACTGG - Intergenic
1008880377 6:56375378-56375400 CTTCCACGGGTGCCTACCACTGG - Intronic
1010500455 6:76593621-76593643 CTGCCGCGGTTTCCTCCCCAAGG - Intergenic
1014742855 6:125166868-125166890 CTGTCACAAATTCCTCCCACTGG - Intronic
1022969671 7:35505560-35505582 CTGCCTCTGTTACTTCCCACAGG - Intergenic
1024179218 7:46872780-46872802 CAGCCACTAATTCCTCCCACAGG + Intergenic
1027971910 7:85094520-85094542 CTTCCTAGCTTTCCTCCCACTGG + Intronic
1029635886 7:101783491-101783513 CTGTCCCGGTTTCCTCCTGCTGG + Intergenic
1034538188 7:151738967-151738989 CTTCCAGGGTTTCATCTCACGGG - Intronic
1035304496 7:157922947-157922969 CTTCCACTGTCTCCTACCACTGG + Intronic
1035701311 8:1640963-1640985 CTGCCACGGCTTCTCCCTACCGG - Intronic
1035723669 8:1812070-1812092 CAGCCACGGTGTCCTCGCTCAGG + Intergenic
1038326420 8:26576476-26576498 CTGCCAGGGCAACCTCCCACGGG + Intronic
1039880973 8:41625458-41625480 CTGCCACATCTTCCTGCCACAGG - Intergenic
1040072590 8:43200734-43200756 TGGCCACGTTTTCCTCACACAGG - Exonic
1041095194 8:54342671-54342693 CTGCCACGCCTTCCTTGCACTGG - Intergenic
1042421731 8:68598461-68598483 GTGCCACGGCCTCTTCCCACTGG - Intronic
1044500644 8:92951456-92951478 CTGTGACGATTTCCTCTCACGGG - Intronic
1044976531 8:97670747-97670769 CTGCCATGGGTTGCTCCCAGAGG - Intronic
1045238190 8:100374659-100374681 ATGCCAGGGTTCCCTCCGACCGG - Intronic
1049002908 8:139837551-139837573 CTGCCTCGGTCTGCTCTCACTGG + Intronic
1049436172 8:142587238-142587260 CCGCCAGGCTTTCCTCCCCCGGG - Intergenic
1049546249 8:143232739-143232761 CTGCCACAGCTTCCCCGCACTGG - Intergenic
1049836336 8:144737974-144737996 CTGACACTGTTACCACCCACAGG + Intronic
1050932532 9:11348625-11348647 CTGCCACGCTTTCTTCCTTCTGG + Intergenic
1053306365 9:36986955-36986977 CTGCCAGGCCTTCCTCCCTCTGG - Intronic
1056198405 9:84250959-84250981 CGGCCAAGGCTTCCTCCCACAGG - Intergenic
1056751838 9:89357601-89357623 CTGCCCCCACTTCCTCCCACGGG - Intronic
1061829324 9:133280746-133280768 CTTCCACCCTTTCCTCCCTCAGG - Intergenic
1061896721 9:133652160-133652182 CGGCCACTGTGTCCTCCCTCAGG - Intronic
1186620161 X:11232241-11232263 CTGCTACTGTTTCCACCCTCTGG + Intronic
1188100171 X:26073021-26073043 GTGCCACTGTGTCCTTCCACTGG - Intergenic
1188513111 X:30957983-30958005 CTCCCGTGGTTTACTCCCACTGG + Intronic
1196178783 X:112668200-112668222 CAGCCTTGGTTTCCTTCCACTGG + Intronic
1198341785 X:135721135-135721157 CTGGTAACGTTTCCTCCCACAGG - Exonic
1198346209 X:135762227-135762249 CTGGTAACGTTTCCTCCCACAGG + Exonic
1198348114 X:135779512-135779534 CTGGTAACGTTTCCTCCCACAGG + Intergenic
1198350020 X:135796774-135796796 CTGGTAACGTTTCCTCCCACAGG + Exonic
1198351931 X:135814047-135814069 CTGGTAACGTTTCCTCCCACAGG + Exonic
1198353834 X:135831316-135831338 CTGGTAACGTTTCCTCCCACAGG + Exonic
1198355747 X:135848565-135848587 CTGGTAACGTTTCCTCCCACAGG + Exonic
1198357658 X:135865844-135865866 CTGGTAACGTTTCCTCCCACAGG + Intergenic
1198359571 X:135883127-135883149 CTGGTAACGTTTCCTCCCACAGG + Exonic
1200802370 Y:7398485-7398507 CTTCCACCCTTTCCTCCCTCAGG + Intergenic
1201620527 Y:15952112-15952134 TTGCCACTGTTTACTCACACAGG - Intergenic