ID: 1160155623

View in Genome Browser
Species Human (GRCh38)
Location 18:76431957-76431979
Sequence CCCGCCCACCACTGCCCTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1116
Summary {0: 1, 1: 0, 2: 2, 3: 59, 4: 1054}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160155612_1160155623 13 Left 1160155612 18:76431921-76431943 CCCCATGCATTCCGCCTCCAGGT 0: 1
1: 0
2: 0
3: 15
4: 122
Right 1160155623 18:76431957-76431979 CCCGCCCACCACTGCCCTGGCGG 0: 1
1: 0
2: 2
3: 59
4: 1054
1160155618_1160155623 -1 Left 1160155618 18:76431935-76431957 CCTCCAGGTGTGTTCAGGCGGCC 0: 1
1: 0
2: 1
3: 19
4: 117
Right 1160155623 18:76431957-76431979 CCCGCCCACCACTGCCCTGGCGG 0: 1
1: 0
2: 2
3: 59
4: 1054
1160155613_1160155623 12 Left 1160155613 18:76431922-76431944 CCCATGCATTCCGCCTCCAGGTG 0: 1
1: 0
2: 0
3: 3
4: 93
Right 1160155623 18:76431957-76431979 CCCGCCCACCACTGCCCTGGCGG 0: 1
1: 0
2: 2
3: 59
4: 1054
1160155610_1160155623 22 Left 1160155610 18:76431912-76431934 CCAGCAGTGCCCCATGCATTCCG 0: 1
1: 0
2: 0
3: 10
4: 111
Right 1160155623 18:76431957-76431979 CCCGCCCACCACTGCCCTGGCGG 0: 1
1: 0
2: 2
3: 59
4: 1054
1160155614_1160155623 11 Left 1160155614 18:76431923-76431945 CCATGCATTCCGCCTCCAGGTGT 0: 1
1: 0
2: 0
3: 11
4: 144
Right 1160155623 18:76431957-76431979 CCCGCCCACCACTGCCCTGGCGG 0: 1
1: 0
2: 2
3: 59
4: 1054
1160155619_1160155623 -4 Left 1160155619 18:76431938-76431960 CCAGGTGTGTTCAGGCGGCCCCG 0: 1
1: 0
2: 1
3: 5
4: 83
Right 1160155623 18:76431957-76431979 CCCGCCCACCACTGCCCTGGCGG 0: 1
1: 0
2: 2
3: 59
4: 1054
1160155616_1160155623 2 Left 1160155616 18:76431932-76431954 CCGCCTCCAGGTGTGTTCAGGCG 0: 1
1: 1
2: 18
3: 45
4: 237
Right 1160155623 18:76431957-76431979 CCCGCCCACCACTGCCCTGGCGG 0: 1
1: 0
2: 2
3: 59
4: 1054

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160155623 Original CRISPR CCCGCCCACCACTGCCCTGG CGG Intronic
900134033 1:1106703-1106725 CCAGCCCACCGCTGCACTGTGGG + Intronic
900213469 1:1468572-1468594 CCCTCCCACCCCTGCCTTTGCGG + Exonic
900221031 1:1509393-1509415 CCCTCCCACCCCTGCCTTTGCGG + Intergenic
900226035 1:1534115-1534137 CCCTCCCACCCCTGCCTTGCCGG + Exonic
900246804 1:1640138-1640160 CCCGCCCGTCACTGCCCCAGTGG + Intronic
900258026 1:1707270-1707292 CCCGCCCGTCACTGCCCCAGTGG + Intronic
900478913 1:2888945-2888967 CCCACCGTCCTCTGCCCTGGAGG + Intergenic
900490800 1:2948227-2948249 ACCGCCAGCCCCTGCCCTGGTGG + Intergenic
900730787 1:4258274-4258296 CCCTCCCATCACAGGCCTGGAGG + Intergenic
900738364 1:4314505-4314527 CCCTCCCATCACAGGCCTGGAGG - Intergenic
900817301 1:4858436-4858458 CCCTCCCATCACAGACCTGGAGG + Intergenic
901205527 1:7493631-7493653 CCCCCCCCCCAGTTCCCTGGGGG - Intronic
901212190 1:7533090-7533112 CCCGGGCACCACAGCGCTGGAGG - Intronic
901236309 1:7669441-7669463 CTGGCCCACCCCTGCCCTGGAGG - Intronic
901297159 1:8169525-8169547 TTCACCCTCCACTGCCCTGGGGG + Intergenic
901396639 1:8986788-8986810 CCCGCCCAACCCTGACCTGCAGG - Intergenic
901634393 1:10663846-10663868 CCCGCTCTCCACTCCTCTGGGGG + Intronic
901702766 1:11054303-11054325 CACCCACCCCACTGCCCTGGGGG + Intergenic
901749149 1:11395421-11395443 CTCGCCCACCCCTCCCCTCGTGG - Intergenic
902291317 1:15437155-15437177 GCCTCCAACCACAGCCCTGGAGG + Intergenic
902505739 1:16938304-16938326 CTGGCCCACCACTGACCAGGTGG - Intronic
902650250 1:17832678-17832700 CCTGCCCCCCACCTCCCTGGGGG - Intergenic
902813839 1:18904803-18904825 CCCTCCCCCCAGGGCCCTGGGGG + Exonic
903139938 1:21333317-21333339 CCAGCCCACCAGAGCCGTGGGGG + Intronic
903154725 1:21435971-21435993 CTGGCCCACCACTGACCAGGTGG - Intergenic
903994673 1:27298268-27298290 CCTGCCCACCATTAGCCTGGAGG - Intronic
904057443 1:27680659-27680681 CCCTCCCATCACAGGCCTGGAGG - Intergenic
904961890 1:34339936-34339958 CACACCTACCAATGCCCTGGAGG - Intergenic
905183299 1:36179327-36179349 CACGCCCAGCACTGCCCTTCGGG - Intronic
905823959 1:41015506-41015528 CCAGCCCACCTCTGTCCAGGAGG - Intergenic
905873090 1:41416130-41416152 CCCGCCCCACTCAGCCCTGGTGG - Intergenic
906078773 1:43070057-43070079 CCCTCCCACCACTCCCCAGATGG + Intergenic
906157560 1:43622690-43622712 CCCGCCCACCACTGTCAATGTGG - Exonic
906251232 1:44312408-44312430 CCCACCCTCCTCTGGCCTGGAGG - Intronic
906371537 1:45258196-45258218 CCCTCCCATCACAGGCCTGGAGG + Intronic
906447690 1:45917512-45917534 CCAGCCGCCCACTGCCGTGGAGG + Intronic
906563573 1:46778951-46778973 TCAGCCCACCACTGCACTGTGGG - Intronic
906664377 1:47608718-47608740 CCCTCCCATCACAGGCCTGGAGG - Intergenic
906681098 1:47725852-47725874 CCCGCTCAGCAGTGCCCTGAAGG - Intergenic
906699384 1:47846938-47846960 CCCGCAGATCACTGCCCAGGAGG - Intronic
907270423 1:53287900-53287922 CCCGCCCACCCCTGCCCTCTTGG - Intronic
908020048 1:59889672-59889694 CCCTCCCATCACAGGCCTGGAGG - Intergenic
908027815 1:59970110-59970132 TCAGCCCACCACTGCACTGTGGG - Intergenic
908299865 1:62753346-62753368 TCAGCCCACCACTGCACTGTGGG + Intergenic
908746888 1:67384464-67384486 CCCTCCCATCACAGGCCTGGAGG - Intronic
909104694 1:71393561-71393583 CCCTCCCATCATAGCCCTGGAGG + Intergenic
909436329 1:75647065-75647087 CCCTCCCATCACAGGCCTGGAGG + Intergenic
910609815 1:89128490-89128512 TCAGCCCACCACTGCACTGTGGG - Intronic
910726893 1:90349277-90349299 CCCTCCCATCACAGGCCTGGAGG + Intergenic
911305293 1:96224785-96224807 TCAGCCCACCACTGCACTGTGGG - Intergenic
911515829 1:98866800-98866822 CCCTCCCATCACAGGCCTGGAGG - Intergenic
911799069 1:102110523-102110545 CCCTCCCACCACAGACCTGGGGG - Intergenic
911848480 1:102784143-102784165 CCCTCCCATCACAGGCCTGGAGG - Intergenic
911853883 1:102853692-102853714 TCAGCCCACCACTGCGCTGAAGG + Intergenic
912112707 1:106363300-106363322 CCCTCCCATCACAGGCCTGGAGG + Intergenic
912279502 1:108298012-108298034 CCCTCCCATCACAGGCCTGGAGG - Intergenic
912288724 1:108396345-108396367 CCCTCCCATCACAGGCCTGGAGG + Intronic
912480453 1:109978600-109978622 CCCACTCACCATTGCCCTGGGGG + Intergenic
913205501 1:116534567-116534589 CCTGCCGCCCACTGCCCTGAAGG - Intronic
913402175 1:118448689-118448711 CCCTCCCATCACAGGCCTGGGGG + Intergenic
914490628 1:148148455-148148477 GCCGCACACCAATGACCTGGGGG + Intronic
915461038 1:156070716-156070738 CCCTCCCCCACCTGCCCTGGGGG - Intergenic
915767217 1:158374570-158374592 TCAGCCCACCACTGCACTGTGGG - Intergenic
915858574 1:159418288-159418310 CCCTCCCACCACAGGCCAGGAGG + Intergenic
916219803 1:162433070-162433092 TCAGCCCACCACTGCACTGTGGG + Intergenic
917035496 1:170743301-170743323 CCCTCCCATCACAGGCCTGGAGG - Intergenic
917290797 1:173470776-173470798 CCCTCCCATCACAGGCCTGGGGG + Intergenic
917396675 1:174601250-174601272 CCCTCCCATCACAGGCCTGGAGG - Intronic
917933060 1:179837376-179837398 TCAGCCCACCACTGCACTGTGGG - Intergenic
918591957 1:186249934-186249956 CCCTCCCATCACAGGCCTGGAGG - Intergenic
918659821 1:187074262-187074284 TCAGCCCACCACTGCACTGTGGG - Intergenic
918718191 1:187818361-187818383 CCCTCCCATCACAGGCCTGGAGG - Intergenic
918920080 1:190698157-190698179 CCCTCCCATCACAGGCCTGGTGG + Intergenic
919117992 1:193305140-193305162 TCAGCCCACCACTGCACTGTGGG - Intergenic
919175111 1:194010226-194010248 CCCTCCCATCACAGGCCTGGAGG + Intergenic
919705362 1:200670089-200670111 CCCGCCCAGCTCTGGGCTGGTGG + Intergenic
921424309 1:214984680-214984702 CCCTCCCATCACAGGCCTGGAGG + Intergenic
921531210 1:216285181-216285203 CCCTCCCATCACAGGCCTGGAGG + Intronic
923088702 1:230722013-230722035 CCCTCCCATCACAGGCCTGGAGG + Intergenic
923198046 1:231686593-231686615 CCCTCCCATCACAGGCCTGGAGG - Intronic
923339205 1:232993696-232993718 CCCTCCCATCACAGGCCTGGAGG + Intronic
923890984 1:238214640-238214662 CCCACCCATCACAGACCTGGAGG - Intergenic
924050769 1:240078019-240078041 CCCTCCCATCACAGGCCTGGAGG + Intronic
924205464 1:241707202-241707224 TACGCCCAACACTGCCCTAGGGG - Intronic
924259377 1:242213793-242213815 CCCACCAAACACTCCCCTGGAGG + Intronic
924806544 1:247366227-247366249 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1063318796 10:5032963-5032985 TCAGCCCACCACTGCACTGTGGG - Intronic
1063481536 10:6380713-6380735 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1064197720 10:13259520-13259542 CCCCCCCCCCACTGCCCTGTGGG + Intergenic
1065347795 10:24765215-24765237 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1065408088 10:25390870-25390892 CCCTCCCATCACAGGCCTGGAGG + Intronic
1066083444 10:31954969-31954991 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1066451819 10:35536992-35537014 CCCTCCCATCACAGGCCTGGAGG + Intronic
1066613658 10:37275770-37275792 TCAGCCCACCACTGCACTGTGGG - Intronic
1067233001 10:44425193-44425215 CGCATCCACCACTGCCTTGGTGG + Intergenic
1067363128 10:45600661-45600683 TCAGCCCACCACTGCACTGTGGG + Intergenic
1068083310 10:52346672-52346694 GCCTCCCACCACTGCCGTGAGGG + Intergenic
1068128382 10:52868480-52868502 CCCTCCCATCACCGGCCTGGAGG + Intergenic
1068235492 10:54227504-54227526 CCCTCCCACCACCAGCCTGGAGG - Intronic
1068495107 10:57776905-57776927 CCCTCCCATCACAGGCCTGGGGG - Intergenic
1068519081 10:58059595-58059617 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1068519520 10:58063068-58063090 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1069077410 10:64052461-64052483 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1069752234 10:70752035-70752057 CAGGCCCCCCATTGCCCTGGTGG - Intronic
1069754585 10:70765903-70765925 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1070245819 10:74730477-74730499 TCCTCCCATCACAGCCCTGGAGG + Intergenic
1070651812 10:78243017-78243039 CCCTCCCATCACAGACCTGGAGG + Intergenic
1070697430 10:78573371-78573393 CCAGAGCACCACTGCCCAGGTGG - Intergenic
1070844816 10:79513356-79513378 CCCTCACACTACAGCCCTGGTGG + Exonic
1070928988 10:80246955-80246977 CCCTCACACTACAGCCCTGGTGG - Intergenic
1071034816 10:81232788-81232810 CCCTCCCATCACAGACCTGGAGG + Intergenic
1071159256 10:82727298-82727320 CCCTCCCATCACAGGCCTGGAGG + Intronic
1071506931 10:86238236-86238258 CCCTCCCATCACAGGCCTGGAGG + Intronic
1071546691 10:86535157-86535179 CCTGCCCTCCACTCACCTGGTGG - Intergenic
1071962714 10:90822714-90822736 CCCTCCCATCACAGGCCTGGAGG + Intronic
1071981067 10:91004631-91004653 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1072021878 10:91410462-91410484 CTCGCCCGCCACTCCGCTGGTGG + Exonic
1072035838 10:91561924-91561946 CCCTCCCATCACAGCCCTGGAGG - Intergenic
1072041490 10:91611176-91611198 CCTTCCCACCCCTGCCATGGAGG - Intergenic
1073043250 10:100621516-100621538 CCCGCCCAGCCCCTCCCTGGCGG + Intergenic
1073883322 10:108008112-108008134 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1074041463 10:109793547-109793569 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1074042935 10:109810168-109810190 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1074069101 10:110048949-110048971 CCCTCCCATCACAGGCCTGGAGG + Intronic
1075269444 10:121035785-121035807 CCCCCCCCCCACTGCACTGTGGG - Intergenic
1075530598 10:123225651-123225673 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1075537592 10:123283798-123283820 TCAGCCCACCACTGCACTGTGGG - Intergenic
1076020961 10:127072761-127072783 TCCTCCCAGCACTGCCATGGTGG + Intronic
1076323687 10:129603936-129603958 CCAGCCCTCCACTGCTCAGGAGG - Intronic
1076693928 10:132237906-132237928 CCCTCCCAACGCTGGCCTGGTGG + Intronic
1076738428 10:132468810-132468832 CACCCCCACCACTGTCCAGGAGG - Intergenic
1076798798 10:132811306-132811328 CCCAGCCTCCTCTGCCCTGGAGG + Intronic
1076919934 10:133446176-133446198 CCGGGCCAGCCCTGCCCTGGCGG + Intergenic
1077130527 11:970044-970066 CCCGGCCACCCCTCTCCTGGAGG + Intronic
1077269134 11:1666848-1666870 CCGGCCCCCCACCGCCCGGGAGG + Intergenic
1077271413 11:1683866-1683888 CCGGCCCCCCACCGCCCGGGAGG - Intergenic
1077740879 11:4843625-4843647 CCCTCCCACTACAGGCCTGGAGG - Intronic
1078379749 11:10829393-10829415 CCCTCCCATCACAGACCTGGAGG - Intronic
1078795763 11:14590984-14591006 TCAGCCCACCACTGCACTGTGGG + Intronic
1079031129 11:16987260-16987282 CACACCCCCCACTGACCTGGTGG + Intronic
1079521126 11:21328146-21328168 CCCTCCCATCACAGGCCTGGAGG + Intronic
1080106085 11:28512777-28512799 TCAGCCCACCACTGCACTGTGGG - Intergenic
1080107554 11:28526229-28526251 TCAGCCCACCACTGCACTGTGGG - Intergenic
1080151416 11:29056643-29056665 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1080153329 11:29078505-29078527 CCCTCCCATCACAGCCCTGGAGG + Intergenic
1080707639 11:34713119-34713141 CCCTCCCATCACAGACCTGGAGG + Intergenic
1080746004 11:35109374-35109396 CCCACCCATCACAGGCCTGGAGG + Intergenic
1081101456 11:39007235-39007257 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1081126998 11:39333513-39333535 TCAGCCCACCACTGCACTGTGGG - Intergenic
1081309495 11:41553372-41553394 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1081441520 11:43086094-43086116 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1082119055 11:48358111-48358133 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1082615022 11:55349233-55349255 CCCTCCCAACACAGGCCTGGAGG + Intergenic
1082652125 11:55806473-55806495 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1082766235 11:57169945-57169967 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1082857725 11:57824033-57824055 ACCTACCACCACTGCCCTGCAGG - Intergenic
1082948039 11:58780781-58780803 CCCTCCCACAACAGGCCTGGAGG - Intergenic
1083136157 11:60678441-60678463 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1083920650 11:65780177-65780199 GGCGGCCACCACTGCCCTGGCGG - Exonic
1084030240 11:66476659-66476681 CCCACCCACCACTCACTTGGGGG - Exonic
1084107347 11:66988720-66988742 TCAGCCCACCACTGCACTGTGGG + Intergenic
1084406138 11:68974686-68974708 TCAGCCCACCACTGCACTGTGGG - Intergenic
1084568638 11:69945838-69945860 CCCTCCCACCTCTGCCCCCGTGG - Intergenic
1085236449 11:75019328-75019350 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1085754988 11:79194903-79194925 CCCTCCCATCACAGCCCTGGAGG + Intronic
1085818868 11:79770858-79770880 TCCTCCCAGCACTGCCCTAGTGG - Intergenic
1086001149 11:81987121-81987143 TCAGCCCACCACTGCACTGTGGG - Intergenic
1086620621 11:88883691-88883713 CCCTCCCATCACAGGCCTGGAGG + Intronic
1086750678 11:90490018-90490040 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1086764281 11:90675639-90675661 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1086826786 11:91508119-91508141 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1086828820 11:91534297-91534319 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1087400942 11:97666997-97667019 TCAGCCCACCACTGCACTGGGGG + Intergenic
1087441243 11:98185664-98185686 TCAGCCCACCACTGCACTGCGGG - Intergenic
1087474580 11:98620214-98620236 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1087486449 11:98763855-98763877 TCAGCCCACCACTGCACTGTGGG - Intergenic
1087763621 11:102127269-102127291 CCCTCCCATCACAGGCCTGGAGG + Intronic
1087793592 11:102432716-102432738 CCCTCCCATCACAGGCCTGGAGG + Intronic
1088443907 11:109902210-109902232 CCCTCCCATCACAGTCCTGGGGG - Intergenic
1088592504 11:111415650-111415672 CCCTCCCAGCTCTGCTCTGGAGG - Intronic
1090202487 11:124866301-124866323 CCCGCCCGCCACAGCTCTGCCGG - Intronic
1090204252 11:124876075-124876097 CACGCCCACGCCTGCGCTGGTGG - Exonic
1090756392 11:129795304-129795326 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1090799080 11:130159668-130159690 CCCGCCCCCGCCGGCCCTGGGGG - Exonic
1091244573 11:134081347-134081369 CCCTCCCATCACAGGCCTGGAGG + Intronic
1091283217 11:134394065-134394087 CGGGCCCACCACAGCCCTGCTGG + Intronic
1091552848 12:1550047-1550069 CCCTCCCATCACAGACCTGGAGG + Intronic
1091658085 12:2360347-2360369 CCAGGCCACACCTGCCCTGGTGG + Intronic
1091798457 12:3310271-3310293 CCCTCCCACCACTTCCCTGTTGG - Intergenic
1092184330 12:6467700-6467722 CCCTCCCATCACAGGCCTGGAGG + Intronic
1092220232 12:6708220-6708242 TCAGCCCACCACTGCACTGTGGG + Intergenic
1092272865 12:7037340-7037362 TCAGCCCACCACTGCACTGTGGG + Intronic
1092947742 12:13472452-13472474 CCAGCCCACTACAACCCTGGAGG + Intergenic
1092995046 12:13941649-13941671 CTCGGCCACCACTTCCCTGTGGG - Intronic
1093038140 12:14352275-14352297 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1093141894 12:15518380-15518402 CCCTCCCATCACAGGCCTGGAGG - Intronic
1093351051 12:18103464-18103486 CCCTCCCATCACAGGCCTGGAGG - Intronic
1093653998 12:21674496-21674518 TCAGCCCACCACTGCACTGTGGG - Intronic
1094037020 12:26082261-26082283 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1094379908 12:29831391-29831413 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1094785820 12:33847002-33847024 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1095803493 12:46293326-46293348 CCCTCCCATCACGGGCCTGGAGG - Intergenic
1095898742 12:47306239-47306261 TCAGCCCACCACTGCGCTGTGGG + Intergenic
1095948463 12:47767179-47767201 CCCCCCCACCCCAGCCCTTGTGG - Intronic
1096102825 12:48979773-48979795 CTCGCCCGCCCATGCCCTGGGGG - Intronic
1096502056 12:52070122-52070144 CCCGCGTTCCACTGCCCCGGGGG - Exonic
1096782587 12:53999741-53999763 CGCGCCCAGCTCGGCCCTGGGGG + Intronic
1096872472 12:54602093-54602115 CCTTCCCACCTCTTCCCTGGGGG + Intergenic
1096875535 12:54627455-54627477 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1097445588 12:59667791-59667813 CCCTCCCATCACAGGCCTGGAGG + Intronic
1097571305 12:61335382-61335404 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1097575631 12:61389262-61389284 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1097617309 12:61898694-61898716 CCCTCCCATCACTGGCCTGTAGG - Intronic
1097654736 12:62344968-62344990 CCCTCCCATCACAGGCCTGGAGG - Intronic
1097955843 12:65484368-65484390 CCCTCCCATCACAGGCCTGGAGG - Intronic
1098163936 12:67673730-67673752 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1098774845 12:74600093-74600115 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1098836771 12:75433122-75433144 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1099096368 12:78379285-78379307 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1099407411 12:82281470-82281492 CCCTCCCATCACAGGCCTGGAGG + Intronic
1099413762 12:82361863-82361885 TCAGCCCACCACTGCACTGTGGG - Intronic
1099450622 12:82802392-82802414 TCAGCCCACCACTGCACTGTGGG - Intronic
1099507714 12:83500045-83500067 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1099523991 12:83696732-83696754 TCAGCCCACCACTGCACTGTGGG - Intergenic
1099675438 12:85755390-85755412 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1099790650 12:87330130-87330152 TCAGCCCACCACTGCACTGTGGG + Intergenic
1099838436 12:87937044-87937066 CCCTCCCATCACAGACCTGGAGG + Intergenic
1101021562 12:100559296-100559318 TCAGCCCACCACTGCACTGTGGG + Intronic
1102197469 12:111035056-111035078 CCGGCTCTCCACCGCCCTGGAGG - Intronic
1102309694 12:111835569-111835591 TCAGCCCACCACTGCACTGTGGG + Intergenic
1102668902 12:114600732-114600754 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1103264535 12:119617965-119617987 CCCTCCCATCACAGGCCTGGAGG + Intronic
1103571768 12:121849656-121849678 TCCACCCACCTCTGCCCTGAGGG + Intronic
1103588386 12:121973051-121973073 CCCTCCCATCACAGTCCTGGAGG + Intronic
1104172147 12:126292210-126292232 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1104240581 12:126985058-126985080 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1104830052 12:131744090-131744112 CCCTCCCATCACAGGCCTGGAGG - Intronic
1104860163 12:131919392-131919414 CCGCCCCACCCCAGCCCTGGCGG - Intronic
1105763086 13:23531468-23531490 TCAGCCCACCACTGCACTGTGGG + Intergenic
1105774021 13:23639690-23639712 CACGCAGACCACTGCCCTGCTGG - Intronic
1105813322 13:24012662-24012684 CCCGCCCACCACACACTTGGGGG - Intronic
1106221393 13:27748760-27748782 CCAGCCCACCGCTGCGCTGTGGG - Intergenic
1106553087 13:30788245-30788267 CCTGCCCACCGCTTCCCTGTCGG - Intergenic
1106592666 13:31110766-31110788 CCCGGCCAGCTCTGCCCTGTGGG - Intergenic
1106643492 13:31609272-31609294 TCAGCCCACCACTGCACTGTGGG - Intergenic
1106734745 13:32577814-32577836 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1108933926 13:55864265-55864287 CCCTCCCATCACAGTCCTGGAGG + Intergenic
1109446673 13:62448344-62448366 TCAGCCCACCACTGCACTGGGGG - Intergenic
1109476210 13:62882789-62882811 CCCTCCCATGACTGGCCTGGAGG - Intergenic
1109537653 13:63739588-63739610 CTCCCCCACCACTGCGATGGGGG + Intergenic
1109538313 13:63742188-63742210 GCCTCCCACCACTGCGATGGGGG + Intergenic
1109655698 13:65387904-65387926 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1109745752 13:66621863-66621885 TCAGCCCACCACTGCACTGTGGG + Intronic
1110940365 13:81341216-81341238 TCAGCCCACCACTGCACTGTGGG - Intergenic
1111065709 13:83089026-83089048 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1111207756 13:85035091-85035113 CCCTCCCATCACTGGCCTGGAGG + Intergenic
1111615027 13:90652180-90652202 CCCTCCCATCACAGGCCTGGGGG + Intergenic
1112475860 13:99730375-99730397 GCAGCCCAGCACTGCCCAGGTGG + Intronic
1112812376 13:103233814-103233836 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1113482749 13:110633475-110633497 TCAGCCCACCACTGCACTGTGGG - Intronic
1113538199 13:111084318-111084340 TCAGCCCACCACTGCACTGTGGG - Intergenic
1113789243 13:113018843-113018865 CCCCCCTCCCACTGCCCAGGCGG + Intronic
1113811852 13:113147512-113147534 GCCCCTCACCACGGCCCTGGGGG - Intronic
1113932696 13:113976674-113976696 CCCACCTCCCACTGCCCTGTAGG + Intergenic
1114566300 14:23635715-23635737 TCAGCCCACCACTGCACTGTGGG + Intronic
1114593470 14:23891671-23891693 TCAGCCCACCACTGCACTGTGGG + Intergenic
1114795727 14:25712742-25712764 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1115475877 14:33812302-33812324 CCCGCCCATCCCCTCCCTGGTGG + Intergenic
1116263513 14:42660635-42660657 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1116387343 14:44348089-44348111 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1116415571 14:44673008-44673030 TCCTCCCATCACTGGCCTGGAGG - Intergenic
1116762048 14:49026875-49026897 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1116854140 14:49937303-49937325 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1116931393 14:50694488-50694510 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1117234288 14:53754853-53754875 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1117256726 14:53985744-53985766 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1117907463 14:60605494-60605516 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1117908273 14:60612262-60612284 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1117977323 14:61311088-61311110 CCCTCCCACCACAGATCTGGAGG - Intronic
1119038773 14:71254209-71254231 TCGGCCCACCACTGCACTGTAGG + Intergenic
1119200517 14:72748610-72748632 CCCTCCCATCACAGGCCTGGAGG + Intronic
1119216401 14:72872248-72872270 CCCTCCCATCACAGGCCTGGAGG - Intronic
1119261340 14:73239866-73239888 CCCGCCCCCGACTCCCCTGCAGG - Intronic
1119305830 14:73607463-73607485 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1119673514 14:76537196-76537218 TCAGCCCACCACTGCACTGTGGG - Intergenic
1119716549 14:76863621-76863643 CCCACACAGCCCTGCCCTGGAGG - Intronic
1119870761 14:78014427-78014449 TCAGCCCACCACTGCACTGTGGG - Intergenic
1120225806 14:81790146-81790168 CCCTTCCATCACTGGCCTGGAGG + Intergenic
1120270612 14:82309367-82309389 CCCTCCCATCACAGGCCTGGCGG + Intergenic
1120326524 14:83036671-83036693 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1120457736 14:84754304-84754326 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1120799828 14:88675554-88675576 CCCTCCCATCACAGGCCTGGAGG - Intronic
1122077994 14:99247880-99247902 CCCCCCATCCCCTGCCCTGGGGG - Intronic
1122300453 14:100728301-100728323 ACAGCCCACCACTGCCCTCGAGG - Intronic
1122535368 14:102458280-102458302 CCCTCCCACCACTGTCAGGGTGG + Intronic
1122609280 14:102970136-102970158 CCCGCCCAGCACTACCTTGAGGG + Exonic
1122770581 14:104095914-104095936 CAGGCCCACCTCGGCCCTGGGGG + Intronic
1122801724 14:104234118-104234140 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1123060581 14:105592456-105592478 CCTGTCCAGCACTGCCCAGGTGG + Intergenic
1123138205 14:106050249-106050271 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1123795557 15:23766931-23766953 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1124201927 15:27686198-27686220 TCAGCCCAACACTGCCTTGGTGG - Intergenic
1124291341 15:28456043-28456065 GCCGCACACCAGTGACCTGGCGG - Intergenic
1124509120 15:30307082-30307104 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1124734439 15:32231580-32231602 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1124883809 15:33665546-33665568 CCCACCCAACACTGTCCTCGTGG + Intronic
1125066142 15:35487635-35487657 CCCTCCCATCACAGGCCTGGAGG - Intronic
1125112149 15:36046868-36046890 TCAGCCCACCACTGCACTGTGGG + Intergenic
1125251751 15:37713207-37713229 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1125472138 15:40014620-40014642 CCCTCCCATCACAGGCCTGGAGG - Intronic
1125519208 15:40338926-40338948 CCTGCCCAGCACTGCCCATGTGG - Intronic
1125522459 15:40355983-40356005 CCCTCACTCCACTTCCCTGGGGG - Intronic
1125609636 15:40961532-40961554 TCAGCCCACCACTGCACTGTGGG + Intergenic
1126647960 15:50894139-50894161 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1126825114 15:52540648-52540670 CCCTCCCATCACAGACCTGGAGG - Intergenic
1127414950 15:58749232-58749254 CCCGCCCCCCACCGCCCTGGCGG - Intronic
1127766922 15:62195398-62195420 CCAGCCCAGCCCTGCCCCGGGGG + Intergenic
1128110782 15:65074939-65074961 TCAGCCCACCACTGCACTGTGGG + Intronic
1129190038 15:73931760-73931782 CCTGCCCACCTCTGCCCTCCAGG + Intronic
1129280459 15:74480790-74480812 TCAGCCCACCACTGCACTGTGGG - Intergenic
1129296367 15:74602434-74602456 CCCGCCCACCTCTAAGCTGGTGG - Intronic
1129549174 15:76429900-76429922 CCCTCCCATCACAGACCTGGAGG + Intronic
1130972268 15:88742212-88742234 CCCGCCCACCACTGAAGGGGCGG + Intergenic
1131121030 15:89823524-89823546 CCTGCCCTGCCCTGCCCTGGGGG - Intergenic
1131402188 15:92134062-92134084 CCAGCCAACCACTGCCCTACTGG - Intronic
1131752671 15:95526373-95526395 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1131980139 15:97986940-97986962 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1132097648 15:98999964-98999986 CCAGCCCACCACTGCACTGTGGG + Intronic
1132122755 15:99192327-99192349 CCCTCCCATCACAGGCCTGGAGG + Intronic
1132510954 16:341181-341203 TCAGCCCACCACTGCACTGTGGG + Intronic
1132804823 16:1770585-1770607 CCCGCCCACCTGGGCCCTGGAGG + Exonic
1132846900 16:2004848-2004870 ACCGCCCACCCCGCCCCTGGTGG - Intronic
1132976018 16:2711574-2711596 CCCACCCACCCCTGGGCTGGAGG + Intergenic
1135034779 16:19067879-19067901 CCCGCCCGCCAGCGCCCCGGAGG - Intronic
1135414241 16:22256922-22256944 TCTGCCCACCACAGCCCTTGGGG + Intronic
1135669351 16:24361885-24361907 CACGCCCAGCACAGCCTTGGGGG + Exonic
1135751134 16:25059356-25059378 TCAGCCCACCACTGCACTGTGGG - Intergenic
1136163235 16:28435284-28435306 TCAGCCCACCACTGCTCTGTGGG + Intergenic
1136199730 16:28679703-28679725 TCAGCCCACCACTGCTCTGTGGG - Intergenic
1136216078 16:28793876-28793898 TCAGCCCACCACTGCTCTGTGGG - Intergenic
1136642338 16:31577566-31577588 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1136911808 16:34149998-34150020 CCCTACCTCCACTGCCTTGGAGG + Intergenic
1137596999 16:49730770-49730792 CGGGCCCACCGCTGTCCTGGAGG - Exonic
1138561177 16:57801960-57801982 CCCTCCCACCACGTCCCTTGGGG - Intronic
1138693667 16:58791231-58791253 TCAGCCCACCACTGCACTGTGGG - Intergenic
1138997599 16:62474026-62474048 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1139466342 16:67155992-67156014 CTCGCCCTCCTCTGCCCTGCTGG - Intronic
1141037864 16:80643833-80643855 CCCTCCCATCACAGGCCTGGAGG - Intronic
1141731438 16:85825536-85825558 CACGCCCACCCCTGGCCTGGGGG - Intergenic
1142102933 16:88285205-88285227 CCTGCCTACCACAGCTCTGGGGG - Intergenic
1142139082 16:88464610-88464632 CCCACCGACCATTGCCATGGCGG - Intronic
1142155964 16:88533052-88533074 CCCGCCCACCCCTCCCCTTCCGG + Intronic
1142840269 17:2623100-2623122 CCCTCCCATCACAGGCCTGGAGG - Intronic
1142905041 17:3035700-3035722 CCCTCTCAGCACTGCCCGGGTGG - Exonic
1143210896 17:5186461-5186483 CCCTCCCATCACAGGCCTGGAGG - Intronic
1143388086 17:6543845-6543867 CCTGCCCACCCCTTCCTTGGAGG - Intronic
1143495804 17:7312052-7312074 CCCTCACACTACAGCCCTGGTGG + Exonic
1143734205 17:8899119-8899141 CCTGCCCACCACAGCCCTCTTGG - Intronic
1144467087 17:15505612-15505634 TCAGCCCACCACTGCACTGTGGG + Intronic
1144723153 17:17486268-17486290 TCAGCCCACCACTGCACTGTGGG + Intronic
1145924199 17:28633627-28633649 CCAGCCCACCTTTGCCCTGGTGG - Exonic
1146391745 17:32429518-32429540 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1146657878 17:34645670-34645692 CCAGCCCACCCCTCCCCTGGTGG + Intergenic
1147375694 17:40021483-40021505 CCCACCAACCACTTCCCTGGAGG - Intronic
1148023312 17:44568132-44568154 TCAGCCCACCACTGCACTGTGGG + Intergenic
1148108371 17:45131407-45131429 CAAGCCCTCCACTGCCCTGCGGG + Intronic
1148261967 17:46192610-46192632 CCCGCACACCCCCGCCCTTGGGG + Exonic
1148366242 17:47057728-47057750 TCAGCCCACCACTGCACTGTGGG - Intergenic
1148640711 17:49185264-49185286 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1148852996 17:50563719-50563741 CCCAACTACCACTCCCCTGGGGG - Intronic
1148961275 17:51395223-51395245 CCCTCCCACCTCAGCCCTGCAGG - Intergenic
1149052751 17:52325859-52325881 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1149079062 17:52632442-52632464 CCCTCCCATCACAGACCTGGAGG + Intergenic
1149341083 17:55687186-55687208 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1150133608 17:62682184-62682206 CCTGCCCTGCTCTGCCCTGGGGG + Intronic
1150133643 17:62682320-62682342 CCTGCCAACTACAGCCCTGGGGG + Exonic
1150203078 17:63377157-63377179 CCCTCCCATCACAGGCCTGGAGG - Intronic
1150250633 17:63702404-63702426 CCCGCCCATCCCTGCCATGCTGG - Intergenic
1150283870 17:63944860-63944882 CCTGCCCCCCACAGCCCTGAGGG + Intronic
1150515682 17:65807520-65807542 CCCTCCCACCATAGGCCTGGAGG + Intronic
1150778215 17:68099198-68099220 TCAGCCCACCACTGCACTGTGGG + Intergenic
1150941502 17:69698574-69698596 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1151135788 17:71944878-71944900 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1151347159 17:73509104-73509126 ACCCCCCACCACTGGCCTGAAGG - Intronic
1151456388 17:74228686-74228708 CCCGCCCCCCACTGATCTTGTGG - Intronic
1151882625 17:76904352-76904374 TCTGCCCCCCGCTGCCCTGGAGG + Exonic
1151957932 17:77389707-77389729 CCCTCCCACCCAGGCCCTGGCGG + Intronic
1152200796 17:78944765-78944787 GCCTCCCAGCACTGCTCTGGAGG + Intergenic
1152583832 17:81180453-81180475 CCCGCTCACCACCACCCTGCTGG + Intergenic
1152640101 17:81445726-81445748 CCCTCCCACCCCTGCCCGGCAGG + Intronic
1152695558 17:81742052-81742074 CCCTCGCACCTCAGCCCTGGAGG + Intergenic
1152897478 17:82921049-82921071 CCGGGACACCACAGCCCTGGGGG - Intronic
1152925009 17:83083177-83083199 CCAACCCACCTCTGCCCAGGAGG - Intronic
1153011990 18:547573-547595 CCCTCCCATCACAGTCCTGGAGG - Intergenic
1153235703 18:2984938-2984960 CCCGCTGACCTCTGCCCTGCTGG - Intronic
1153317903 18:3742305-3742327 CCTGACCACCGCTGCCCTGACGG + Intronic
1153556857 18:6323919-6323941 CCCTCCCATCACAGGCCTGGAGG + Intronic
1153796846 18:8631468-8631490 TCTGCCCACTACTGCCCTGCTGG + Intronic
1153868743 18:9297212-9297234 CCCCCCAACCCCTGCCCTGTGGG + Intergenic
1154173420 18:12067145-12067167 CCCGCCTGACACCGCCCTGGAGG + Intergenic
1155554251 18:27000802-27000824 CCCTCCTACCACATCCCTGGAGG + Intronic
1155611775 18:27674308-27674330 TCAGCCCACCACTGCACTGTGGG - Intergenic
1155632178 18:27906431-27906453 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1155852219 18:30788359-30788381 TCAGCCCACCACTGCACTGTGGG + Intergenic
1155856440 18:30839603-30839625 TCAGCCCACCACTGCACTGTGGG - Intergenic
1156940942 18:42766718-42766740 CCCTCCTATCACTGGCCTGGAGG + Intronic
1156943112 18:42795163-42795185 TCAGCCCACCACTGCACTGTGGG + Intronic
1157085907 18:44580648-44580670 TCAGCCCACCACTGCACTGTGGG + Intergenic
1157294987 18:46435822-46435844 CCCACCCAGCACTGCCTTGCTGG - Intronic
1157818702 18:50749967-50749989 CCCGCCCCCCACCTTCCTGGTGG - Intergenic
1158697325 18:59714537-59714559 TCAGCCCACCACTGCACTGTGGG - Intergenic
1158705819 18:59790896-59790918 TCAGCCCACCACTGCACTGTGGG - Intergenic
1158833223 18:61303246-61303268 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1159075382 18:63675264-63675286 TACTCCCACCACTGCCCTGTAGG - Intronic
1159357719 18:67358644-67358666 CTCTCCCATCACAGCCCTGGGGG + Intergenic
1159462661 18:68740598-68740620 CCTCCTCACCACTGCACTGGTGG - Intronic
1159502126 18:69286788-69286810 CCCTCCCAGCACTGCCATGTTGG + Intergenic
1159717925 18:71849053-71849075 CCCTCCCAACACAGGCCTGGAGG + Intergenic
1159743894 18:72209040-72209062 TCAGCCCACCACTGCGCTGTGGG + Intergenic
1159962463 18:74566210-74566232 CCCACCCATCACAGGCCTGGAGG - Intronic
1160066784 18:75583100-75583122 CGTGCCCGGCACTGCCCTGGTGG - Intergenic
1160155623 18:76431957-76431979 CCCGCCCACCACTGCCCTGGCGG + Intronic
1160176686 18:76600575-76600597 TCAGCCCACCACTGCACTGTGGG - Intergenic
1160509978 18:79448008-79448030 CCCGGCCACTAGTGTCCTGGCGG + Intronic
1160599360 18:80001012-80001034 CCCTCCCATCACAGGCCTGGAGG + Intronic
1160877741 19:1305045-1305067 GCCGCCCCCCACAGCCCCGGTGG + Intergenic
1160994990 19:1878371-1878393 GCCGCACACCAATGACCTGGGGG - Intronic
1161010403 19:1957079-1957101 CCCGCCCACCAATCTCCGGGTGG - Intronic
1161104578 19:2437007-2437029 CCCCTTCACAACTGCCCTGGCGG + Intronic
1162109858 19:8394095-8394117 CCAGCCCGCCACTGCCCCGCTGG + Intronic
1162262990 19:9547737-9547759 TCCACCCACCACTGCACTGTGGG + Intergenic
1162301499 19:9847575-9847597 CTCTCCCACCTCTGCCCAGGGGG + Intronic
1164144090 19:22499434-22499456 TCAGCCCACCACTGCACTGTGGG - Intronic
1164609282 19:29621258-29621280 CCAGCCCACCCCTGCCATCGTGG + Intergenic
1164720157 19:30426014-30426036 CCGACCCACCACTGCTCTGCTGG - Intronic
1165365672 19:35363348-35363370 CCAGACCACCCCTGCCCAGGTGG + Intergenic
1166054013 19:40277940-40277962 CCCCCTCCCCACTGCCCTAGGGG - Intronic
1166719007 19:44986929-44986951 CCAGCCCACGGCTGCCCTGTGGG - Intronic
1166740147 19:45109648-45109670 CCAGCCCACCACAGCTATGGAGG + Intronic
1166811236 19:45515871-45515893 CCCCTCCCCCACTGCCCTGGAGG + Intronic
1166873806 19:45885531-45885553 CCCGGCCACCAAGGACCTGGCGG - Exonic
1166999646 19:46738373-46738395 CCCCCACACCCCTGGCCTGGTGG + Intronic
1168137928 19:54364230-54364252 CCCACCCAGCACTGCCCTTGGGG + Intronic
1168160002 19:54503778-54503800 CCCACCCAGCACTGCCTTTGGGG - Intronic
1168290237 19:55354063-55354085 CCCGCCTCCCTCTCCCCTGGAGG + Exonic
1168496167 19:56853636-56853658 CCCTCCCATCACAGGCCTGGAGG + Intergenic
925082325 2:1080081-1080103 CCCCCTCGCCACCGCCCTGGGGG - Intronic
925172669 2:1759756-1759778 TCAGCCCACCACTGCACTGTGGG - Intergenic
925225976 2:2184675-2184697 CACGCCCACCAATGGGCTGGCGG + Intronic
925389139 2:3483657-3483679 CCCTCCCTCCACTGCCGGGGGGG - Intronic
925498933 2:4483214-4483236 CCCTCCCATCACAGGCCTGGAGG + Intergenic
925527062 2:4814341-4814363 CCCTCCCATCACAGGCCTGGAGG - Intergenic
925919711 2:8630654-8630676 CCCACCCGGCTCTGCCCTGGTGG + Intergenic
925922426 2:8646701-8646723 CCCACAGCCCACTGCCCTGGGGG + Intergenic
926508085 2:13740869-13740891 CCCTCCCATCACAGGCCTGGAGG + Intergenic
926768970 2:16351286-16351308 CCCTCCCATCACAGGCCTGGAGG + Intergenic
926929659 2:18024014-18024036 CCCTCCCATCACAGGCCTGGAGG - Intronic
927341940 2:21992582-21992604 CCCTCCCATCACAGGCCTGGAGG - Intergenic
927544405 2:23940315-23940337 CCTTCCCACCACTGGCCCGGCGG - Intronic
927670216 2:25062724-25062746 GCCTCCCCCCACTGCCCTGCCGG - Intronic
927862806 2:26570733-26570755 CTCGCCCATCACTGCACTGTAGG - Intronic
928725826 2:34172204-34172226 CCCTCCCATCACTAGCCTGGAGG - Intergenic
929081555 2:38127421-38127443 CCCTCCCATCACAGGCCTGGAGG + Intergenic
929211300 2:39359910-39359932 CCCTCCCATCACAGCCCTGGAGG - Intronic
929233648 2:39585281-39585303 TCAGCCCACCACTGCACTGTGGG + Intergenic
929358069 2:41050568-41050590 CCCTCCCATCACAGGCCTGGAGG + Intergenic
930593341 2:53356354-53356376 TCAGCCCACCACTGCACTGTGGG + Intergenic
931457725 2:62425123-62425145 CCTGCCCATCCCTGTCCTGGAGG + Intergenic
931949884 2:67350350-67350372 CCCTCCCATCACAGGCCTGGAGG - Intergenic
931983715 2:67721699-67721721 CCCTCCCATCACAGGCCTGGAGG + Intergenic
932053125 2:68418761-68418783 CCCTCCCACCACCCCCATGGAGG - Intergenic
932923268 2:75941746-75941768 CCCTCCCATCACAGGCCTGGAGG + Intergenic
932956437 2:76356970-76356992 CCCTCCCATCACAGGCCTGGAGG + Intergenic
933047549 2:77558028-77558050 CCCTCCCATCACAGGCCTGGAGG + Intronic
933060902 2:77735200-77735222 TCAGCCCACCACTGCACTGTGGG - Intergenic
933573015 2:84035864-84035886 TCTGCCTCCCACTGCCCTGGTGG - Intergenic
933578146 2:84093048-84093070 CCCTCCCATCACAGGCCTGGAGG - Intergenic
933790715 2:85881925-85881947 CCCTCCCATCACAGGCCTGGAGG + Intronic
934571056 2:95373753-95373775 CCCTGCCCCCACAGCCCTGGAGG + Intronic
934655850 2:96116559-96116581 CCCGCTCCCCACTCCCCTGCAGG - Intergenic
936151727 2:110025525-110025547 TCTGGCCACTACTGCCCTGGAGG - Intergenic
936192947 2:110345844-110345866 TCTGGCCACTACTGCCCTGGAGG + Intergenic
936499596 2:113055400-113055422 CCCTCCCATCACAGACCTGGAGG - Intergenic
936563527 2:113563232-113563254 ACAGCCAGCCACTGCCCTGGAGG + Intergenic
936831866 2:116656266-116656288 CCCTCCCATCACAGGCCTGGAGG - Intergenic
937008883 2:118543918-118543940 CCCTCCCATCACAGGCCTGGAGG + Intergenic
937230825 2:120397164-120397186 CCTGCCCTGCCCTGCCCTGGGGG + Intergenic
937380698 2:121374064-121374086 CCCTCCCATCACAGACCTGGAGG + Intronic
937561041 2:123223994-123224016 CCCTCCCATCACAGGCCTGGAGG - Intergenic
937620558 2:123980449-123980471 CCCTCCCATCACAGACCTGGAGG + Intergenic
937746535 2:125422161-125422183 TCAGCCCACCACTGCACTGTGGG + Intergenic
938554969 2:132416277-132416299 CACGTCCACCGCTGCCCTGGGGG - Intergenic
938698117 2:133853052-133853074 CCCTCCCATCACAGGCCTGGAGG + Intergenic
938868903 2:135453266-135453288 CCCTCCCATCACAGGCCTGGAGG - Intronic
939037352 2:137148985-137149007 CCCTCCCATCACAGGCCTGGAGG + Intronic
939137675 2:138315856-138315878 CCCTCCCATCACAGGCCTGGAGG - Intergenic
939224968 2:139353632-139353654 CCCTCCCATCACAGGCCTGGAGG + Intergenic
939578047 2:143919413-143919435 CCCTCCCATCACAGGCCTGGAGG + Intergenic
939667068 2:144965335-144965357 CCCTCCCATCACAGGCCTGGAGG + Intergenic
940362002 2:152805261-152805283 TCAGCCCACCACTGCACTGTGGG - Intergenic
940408741 2:153335828-153335850 CCCTCCCATCACGGACCTGGAGG + Intergenic
940543030 2:155046069-155046091 CCCTCCCATCACAGGCCTGGAGG - Intergenic
940826300 2:158416248-158416270 CCCTCCCATCACAGCCCTGGAGG - Intronic
941303201 2:163829090-163829112 CCCTCCCATCACAGGCCTGGAGG - Intergenic
941712187 2:168725343-168725365 TCAGCCCACCACTGCACTGTGGG - Intronic
941728846 2:168893200-168893222 CCCTCCCACCACTATGCTGGAGG + Intronic
942170320 2:173283033-173283055 TCAGCCCACCACTGCACTGTGGG - Intergenic
942203294 2:173593325-173593347 CCCTCCCATCACAGGCCTGGAGG - Intergenic
942387777 2:175460565-175460587 CCCTCCCATCACAGGCCTGGAGG + Intergenic
942724801 2:178994521-178994543 CCCTCCCATCACAGGCCTGGAGG - Intronic
943423282 2:187697551-187697573 CCCTCCCATCACAGACCTGGAGG + Intergenic
943543326 2:189244083-189244105 CCCTCCCATCACAGGCCTGGAGG - Intergenic
943620274 2:190140701-190140723 CCCTCCCATCACAGGCCTGGAGG - Intronic
943944677 2:194044414-194044436 CCCTCCCATCACAGGCCTGGAGG + Intergenic
944010195 2:194965351-194965373 CCCTCCCATCACAGACCTGGAGG - Intergenic
944728535 2:202496825-202496847 TCAGCCCACCACTGCACTGTGGG + Intronic
944857998 2:203786021-203786043 TCAGCCCACCACTGCACTGTGGG - Intergenic
945166688 2:206954073-206954095 CCCTCCCATCACAGGCCTGGAGG - Intronic
945534018 2:210989584-210989606 CCCTCCCATCACAGGCCTGGAGG + Intergenic
945618644 2:212106683-212106705 CCCTCCCATCACAGGCCTGGAGG + Intronic
946351857 2:219160569-219160591 CCCGCCCACCCCTCCCCCGGAGG + Intronic
946732294 2:222721041-222721063 CCCTCCCATCACAGGCCTGGAGG - Intergenic
947026565 2:225744044-225744066 TCAGCCCACCACTGCACTGTGGG + Intergenic
947488237 2:230571717-230571739 CCCTCCCATCACAGGCCTGGAGG - Intergenic
947893480 2:233646263-233646285 CCCTCCCATCACAGGCCTGGAGG - Intronic
947903059 2:233738900-233738922 CCCTCCCATCACAGGCCTGGAGG + Intronic
947904476 2:233750565-233750587 CCCTCCCATCACAGGCCTGGAGG + Intronic
948431663 2:237922833-237922855 CGGGGCCACCCCTGCCCTGGAGG + Intergenic
948489556 2:238303721-238303743 CCTCCCCTCCAATGCCCTGGAGG - Intergenic
948505835 2:238426648-238426670 CCCGCCCGCCACGGCCCTCGGGG + Intergenic
948773138 2:240262681-240262703 CCCTCCCATCACAGGCCTGGAGG + Intergenic
948837655 2:240633860-240633882 CCCACCCATCACAGGCCTGGAGG + Intergenic
948873626 2:240816447-240816469 CCCTCCCCACAGTGCCCTGGAGG - Intronic
949009620 2:241671099-241671121 CCCACCCCCCTCTGCCGTGGTGG + Intronic
1169346015 20:4828629-4828651 GCTGTCCACCACTGCCCTGCTGG + Intergenic
1169849129 20:10031596-10031618 TCAGCCCACCACTGCACTGTGGG + Intronic
1169948003 20:11010130-11010152 CCCGCCCACAGCTTTCCTGGGGG + Intergenic
1170004017 20:11646545-11646567 CCTGGAGACCACTGCCCTGGGGG + Intergenic
1170310026 20:14982453-14982475 CCCTCCCATCACAGGCCTGGAGG + Intronic
1170741771 20:19064941-19064963 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1171001928 20:21423547-21423569 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1171399632 20:24864593-24864615 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1171946005 20:31378160-31378182 CCCTCCCTCCACTTCCCTGATGG + Intronic
1172528659 20:35616353-35616375 CCCGCCCAGCACCGCCCTTTAGG - Intronic
1172530176 20:35625639-35625661 CCAGCCCAGCTCTGCCCTGAGGG + Intergenic
1172812037 20:37654978-37655000 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1174183109 20:48687278-48687300 CCCGTCCACAACTGCACTCGTGG + Intronic
1175195425 20:57239939-57239961 CCCTCCCATCACAGGCCTGGAGG - Intronic
1175258879 20:57662797-57662819 CCAGCCCACATCAGCCCTGGAGG + Intronic
1175297504 20:57919203-57919225 CCCTCCCACCTCTTCCCTGCTGG - Intergenic
1175844040 20:62049313-62049335 CATGCTCACCACTGCCCTGCAGG - Intronic
1175851033 20:62093095-62093117 CCTGCCCAGCAGAGCCCTGGGGG + Intergenic
1176022332 20:62968163-62968185 CCACCCACCCACTGCCCTGGGGG - Exonic
1176546173 21:8201210-8201232 CCCCCCCACCACCGCCTTGGTGG + Intergenic
1176565124 21:8384256-8384278 CCCCCCCACCACCGCCTTGGTGG + Intergenic
1177067903 21:16463854-16463876 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1177139652 21:17344517-17344539 CTCTCCCACCACAGGCCTGGAGG + Intergenic
1177478112 21:21650871-21650893 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1177525671 21:22287471-22287493 CCCTCCCACCAAAGGCCTGGAGG + Intergenic
1177528992 21:22336704-22336726 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1177952230 21:27552514-27552536 CCCTCCCATCACAGCACTGGAGG - Intergenic
1178082276 21:29077563-29077585 TCAGCCCACCACTGCGCTGTGGG - Intronic
1178173941 21:30075681-30075703 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1179902852 21:44402822-44402844 CCCCCTCACCACTGCCCTGAGGG - Intronic
1180153393 21:45964784-45964806 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1180155974 21:45977608-45977630 CCAGGAAACCACTGCCCTGGGGG - Intergenic
1180741113 22:18053802-18053824 TCAGCCCACCACTGCACTGTGGG - Intergenic
1181033175 22:20157881-20157903 CCCGCCCTCCCCTGCTGTGGGGG - Intergenic
1181051588 22:20240613-20240635 CTCCCCAGCCACTGCCCTGGCGG + Intergenic
1181086191 22:20440527-20440549 CCCACATACCACAGCCCTGGGGG + Intronic
1181121048 22:20668905-20668927 GCCGCACACCAGTGACCTGGGGG - Intergenic
1181273764 22:21675938-21675960 GCAGCCCACCCCTGCCCAGGTGG + Intronic
1181334012 22:22115931-22115953 GCCGCACACCAGTGACCTGGGGG - Intergenic
1181644790 22:24225483-24225505 CCCTCCCTCCTCTCCCCTGGTGG + Intronic
1182945259 22:34316075-34316097 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1183264541 22:36817242-36817264 CCCGCGGACCCCTGGCCTGGCGG - Intronic
1183475435 22:38033602-38033624 CCCAACCCCCACTGCACTGGGGG - Intronic
1183613489 22:38927258-38927280 CACTCCCACCACCGCCCGGGTGG - Intergenic
1183685148 22:39357452-39357474 TCAGCCCACCACTGCACTGTGGG + Intronic
1184035688 22:41917091-41917113 CCCTCTGCCCACTGCCCTGGAGG + Intergenic
1184226049 22:43129339-43129361 CCCCATGACCACTGCCCTGGAGG + Exonic
1184311885 22:43651161-43651183 CCCTCCCATCACAGGCCTGGAGG + Intronic
1184319911 22:43733403-43733425 CCTACTCTCCACTGCCCTGGAGG - Intronic
1184650843 22:45918900-45918922 CCTGGCCACCCCTGCCCTGCAGG - Intergenic
1184661540 22:45967692-45967714 CCCACCCACCACATCCCCGGAGG - Intronic
1184713305 22:46265798-46265820 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1184778528 22:46635202-46635224 CCCGGCCACTCCTGTCCTGGGGG + Intronic
1184778567 22:46635294-46635316 CCCGGCCACTCCTGTCCTGGGGG + Intronic
1184778603 22:46635386-46635408 CCCGGCCACTCCTGTCCTGGGGG + Intronic
1184778696 22:46635615-46635637 CCCGGCCACTCCTGTCCTGGGGG + Intronic
1185272165 22:49934674-49934696 ACCGCCCCCCACTCCCCTGCAGG - Intergenic
1185339207 22:50284102-50284124 CCCGCCCCCCACTGCGCCCGTGG + Intronic
1185364881 22:50432907-50432929 CCCGCCCAACCCTCCCCTTGGGG + Intronic
1203251045 22_KI270733v1_random:117447-117469 CCCCCCCACCACCGCCTTGGTGG + Intergenic
949562328 3:5214278-5214300 CCTGACCACCAAGGCCCTGGGGG - Intronic
950025272 3:9815882-9815904 TCTGCCCACCTGTGCCCTGGAGG + Intronic
950261266 3:11544620-11544642 CCCGCCCACCCCTGTCCTTCTGG + Intronic
950513435 3:13447642-13447664 TCAGCCCCCCACTGCCCTGTGGG - Intergenic
951358996 3:21702443-21702465 CCCTCCCATCACAGGCCTGGAGG - Intronic
951756496 3:26096667-26096689 CCCTCCCATCACAGGCCTGGAGG - Intergenic
951865092 3:27299134-27299156 CCCTCCCATCACAGGCCTGGAGG + Intronic
952058153 3:29473947-29473969 TCAGCCCACCACTGCACTGTGGG - Intronic
952593571 3:34988279-34988301 TCAGCCCACCACTGCACTGTGGG + Intergenic
952608771 3:35181822-35181844 CCCTCCCATCACAGACCTGGAGG - Intergenic
952715132 3:36472320-36472342 CCCTCCCATCACAGGCCTGGAGG - Intronic
953095026 3:39766613-39766635 CCCTCCCATCACTGGCCTGGAGG - Intergenic
953898541 3:46823543-46823565 CCCTCCCATCACAGGCCTGGAGG - Intergenic
954450978 3:50571611-50571633 CCTGCCCAGCACTGGTCTGGAGG - Intronic
954493200 3:50927263-50927285 CCCACTCCCCACTGCCCTGTGGG - Intronic
955210226 3:56934381-56934403 TCAGCCCACCACTGCACTGTGGG + Intronic
956169585 3:66422119-66422141 CCCTCCCATCACAGGCCTGGAGG - Intronic
956185728 3:66560123-66560145 CCCTCCCATCACAGGCCTGGAGG - Intergenic
956391599 3:68779437-68779459 CCCTCCCATCACAGGCCTGGAGG + Intronic
956474919 3:69609815-69609837 CCCTCCCATCACAGGCCTGGAGG + Intergenic
957524087 3:81357955-81357977 CCCTCCCATCACAGGCCTGGAGG + Intergenic
958057120 3:88427506-88427528 CCCTCCCATCACAGGCCTGGGGG + Intergenic
958419817 3:93917530-93917552 TCAGCCCACCACTGCACTGTGGG + Intronic
958543399 3:95509849-95509871 CCCTCCCATCACAGACCTGGAGG + Intergenic
958893489 3:99805381-99805403 CCCTCCCATCACAGGCCTGGAGG - Intergenic
958969005 3:100590549-100590571 CCTGGCCATCACTGTCCTGGTGG - Intergenic
959140990 3:102486757-102486779 CCCTCCCATCACAGGCCTGGAGG + Intergenic
959851764 3:111096558-111096580 CCCTCCCATCACAGGCCTGGAGG + Intronic
959873883 3:111359866-111359888 CCTCCCCACCACAGCCCTGGAGG + Intronic
960021774 3:112963845-112963867 CCCTCCCATCACAGGCCTGGAGG + Intronic
960060180 3:113312612-113312634 CCCTCCCATCACAGGCCTGGAGG + Intronic
960541918 3:118871183-118871205 CCCTCCCATCACAGACCTGGAGG + Intergenic
960563896 3:119114109-119114131 CCCTCCCATCACAGGCCTGGAGG - Intronic
961460400 3:127046592-127046614 TCAGCCCACCACTGCACTGTGGG + Intergenic
961550597 3:127668625-127668647 CCCGCCTCCCACTGCCCTCCTGG - Intronic
961961927 3:130864563-130864585 CCCTCCCATCACAGGCCTGGAGG + Intronic
962162222 3:133011915-133011937 CCCTCCCATCACAGGCCTGGAGG - Intergenic
962283814 3:134070704-134070726 TCAGCCCACCACTGCACTGTGGG - Intronic
962421637 3:135233990-135234012 CCCTCCCATCACAGACCTGGAGG - Intronic
962440241 3:135406550-135406572 CCCTCCCATCACAGGCCTGGAGG - Intergenic
962509433 3:136084140-136084162 CCCTCCCATCACAGGCCTGGAGG + Intronic
962576880 3:136763198-136763220 CCCTCCCATCACAGGCCTGGAGG + Intergenic
962591140 3:136890445-136890467 TCAGCCCACCACTGCACTGTGGG - Intronic
962758189 3:138484571-138484593 TCGGCCCACCACTGCACTGTGGG + Intergenic
962867748 3:139461730-139461752 CCAGCCAAGCACTGCCATGGAGG - Intronic
963049535 3:141129194-141129216 CCTGCCCACCTCTGCTGTGGAGG + Intronic
963297062 3:143557992-143558014 CCCTCCCATCACAGGCCTGGAGG + Intronic
963391204 3:144665863-144665885 CCCTCCCATCACAGGCCTGGAGG - Intergenic
963509213 3:146225871-146225893 TCAGCCCACCACTGCACTGTGGG - Intronic
963593043 3:147286758-147286780 CCCTCCCATCACAGGCCTGGAGG - Intergenic
963683593 3:148410692-148410714 CCCTCCCATCACAGTCCTGGAGG - Intergenic
964118037 3:153156165-153156187 TCAGCCCACCACTGCACTGTGGG - Intergenic
964737857 3:159934474-159934496 CCCTCCCATCACAGGCCTGGAGG - Intergenic
964790465 3:160449804-160449826 CCCGCCCTCCTCTGCCCCGAAGG + Exonic
964792961 3:160470316-160470338 CCCTCCCATCACAGGCCTGGAGG + Intronic
964836114 3:160940412-160940434 CCCTCCCATCACAGGCCTGGAGG + Intronic
964978380 3:162647453-162647475 CCCTCCCATCACAGGCCTGGAGG + Intergenic
964989163 3:162785220-162785242 CCCTCCCATCACAGGCCTGGAGG - Intergenic
965044199 3:163552766-163552788 TCAGCCCACCACTGCACTGTTGG - Intergenic
965146619 3:164913152-164913174 CCCTCCCATCACAGGCCTGGAGG - Intergenic
965220273 3:165918891-165918913 TCAGCCCACCACTGCACTGTGGG - Intergenic
965499966 3:169445232-169445254 CCCTCCCATCACAGGCCTGGAGG + Intronic
965943553 3:174212417-174212439 TCAGCCCACCACTGCACTGTGGG - Intronic
966074996 3:175924965-175924987 CCCTCCCATCACAGGCCTGGAGG - Intergenic
966972765 3:185060795-185060817 CCCTCCCAACACAGGCCTGGAGG + Intergenic
967513711 3:190341563-190341585 CCCTCCCATCACAGACCTGGAGG - Intronic
967635057 3:191791158-191791180 CCCTCCCATCACAGGCCTGGAGG - Intergenic
967701517 3:192598062-192598084 ACCACCCACAACTTCCCTGGTGG + Intronic
968601768 4:1513036-1513058 CCCGCCCAGCACCGCCCAGGAGG + Intergenic
968649662 4:1755491-1755513 CCCGCCCAGCACTCGCCTCGGGG + Intergenic
968658693 4:1789820-1789842 CCGGCCCAGCCCAGCCCTGGCGG - Intergenic
968871272 4:3243808-3243830 CTCGCCCATCACAGCCCTGCTGG - Exonic
968909716 4:3471472-3471494 CCGGGCCACCTCTGCCTTGGGGG - Intronic
969406528 4:6996709-6996731 CCCGCCCGGGACAGCCCTGGGGG - Intronic
969561314 4:7950137-7950159 CCCGCCCATGTCTGCCCAGGTGG - Intergenic
969694828 4:8728615-8728637 TCCACCCACCTCTGCCCTGGGGG - Intergenic
969788178 4:9474445-9474467 GCCGCGCACCCCTGCCATGGGGG - Intergenic
970047872 4:11876309-11876331 CCCTCCCATCACAGGCCTGGAGG - Intergenic
970344074 4:15136190-15136212 CCCTCCCATCACAGGCCTGGAGG - Intergenic
970391153 4:15614829-15614851 TCAGCCCACCACTGCACTGTGGG + Intronic
970554266 4:17215396-17215418 CCCTCCCATCACAGGCCTGGAGG - Intergenic
970818898 4:20190518-20190540 CCTTCCCACCACAGGCCTGGAGG + Intergenic
971753273 4:30678137-30678159 CCCTCCCATCACAGGCCTGGAGG + Intergenic
971912372 4:32810536-32810558 CCCTCCCATCACAGGCCTGGGGG - Intergenic
971948641 4:33315138-33315160 CCCTCCCAACACAGGCCTGGAGG + Intergenic
972022845 4:34336086-34336108 TCAGCCCACCACTGCACTGTGGG - Intergenic
973048515 4:45566971-45566993 TCAGCCCAACACTGCACTGGGGG + Intergenic
973308016 4:48675256-48675278 TCAGCCCACCACTGCACTGTGGG + Intronic
973724729 4:53763943-53763965 CCTGGCCCCCACTGCCCTGCTGG + Intronic
974012988 4:56624498-56624520 CCCTCCCATCACAGGCCTGGAGG + Intergenic
974147648 4:57967110-57967132 TCAGCCCACCACTGCACTGTGGG + Intergenic
974202830 4:58663156-58663178 CCCTCCCATCACAGGCCTGGAGG - Intergenic
974495010 4:62615124-62615146 CCCTCCCATCACAGGCCTGGAGG - Intergenic
974563512 4:63553333-63553355 CCCTCCCATGACAGCCCTGGAGG - Intergenic
974679911 4:65147168-65147190 CCCACCCATCACAGGCCTGGAGG - Intergenic
975160640 4:71120843-71120865 TCAGCCCACCACTGCACTGTGGG + Intergenic
975257516 4:72255457-72255479 CCCTCCCATCACAGACCTGGAGG + Intergenic
975507061 4:75149012-75149034 CCCTCCCATCACAGACCTGGAGG - Intergenic
975729277 4:77321499-77321521 CCCTCCCATCACAGGCCTGGAGG - Intronic
975744897 4:77466301-77466323 TCAGCCCACCACTGCACTGTGGG + Intergenic
975754763 4:77561803-77561825 TCAGCCCACCACTGCACTGTGGG + Intronic
976000825 4:80371285-80371307 CCCTCCCATCACAGGCCTGGAGG - Intronic
976057047 4:81081221-81081243 CCCTCCCATCACAGGCCTGGAGG + Intergenic
976218784 4:82739485-82739507 GCCTCCCCGCACTGCCCTGGAGG + Intronic
976286477 4:83375731-83375753 CCCTCCCATCACAGGCCTGGAGG - Intergenic
976405655 4:84658361-84658383 CCCTCCCATCACAGGCCTGGAGG - Intergenic
976406322 4:84664633-84664655 TCAGCCCACCACTGCACTGTGGG + Intergenic
976503182 4:85815165-85815187 CCCTCCCATCACAGTCCTGGAGG - Intronic
976988110 4:91327506-91327528 CCCTCCCATCACAGGCCTGGAGG - Intronic
977063842 4:92288565-92288587 CCCTCCCATCACAGGCCTGGAGG - Intergenic
977512002 4:97973601-97973623 CCCTCCCATCACAGGCCTGGAGG + Intronic
977545006 4:98367062-98367084 CCCTCCCATCACAGGCCTGGAGG + Intronic
977592429 4:98841945-98841967 CCCTCCCATCACAGGCCTGGAGG + Intergenic
978234984 4:106447028-106447050 CCCTCCCACCACAGGCCTGGAGG - Intergenic
978287833 4:107099222-107099244 CCTGCACCCCACTGCCCTGAAGG + Intronic
978492495 4:109323598-109323620 CCCTCCCATCACAGGCCTGGGGG - Intergenic
978579581 4:110218520-110218542 CCCTCCCATCACAGACCTGGAGG - Intergenic
978939022 4:114415312-114415334 CCCTCCCATCACAGGCCTGGAGG + Intergenic
978991200 4:115084503-115084525 CCCTCCCATCACAGGCCTGGAGG + Intronic
979368054 4:119848515-119848537 CCCTCCCATCACAGGCCTGGAGG - Intergenic
979391951 4:120138388-120138410 CCCTCCCATCACAGGCCTGGAGG - Intergenic
979411427 4:120384415-120384437 CCCTCCCATCACAGGCCTGGAGG + Intergenic
979426455 4:120572797-120572819 CCCTCCCATCACAGGCCTGGAGG - Intergenic
979825768 4:125230034-125230056 TCAGCCCACCACTGCACTGTGGG - Intergenic
979829295 4:125280865-125280887 TCAGCTCACCACTGCACTGGGGG + Intergenic
979895892 4:126156734-126156756 CCCTCCCATCACAGGCCTGGAGG - Intergenic
979895912 4:126156828-126156850 CCCTCCCATCACAGGCCTGGAGG - Intergenic
980346798 4:131633012-131633034 CCCTCCCATCACAGGCCTGGAGG + Intergenic
980458247 4:133073038-133073060 CCCTCCCATCACAGGCCTGGAGG + Intergenic
980596487 4:134962132-134962154 CCCTCCCATCACAGGCCTGGAGG + Intergenic
980702766 4:136454618-136454640 CCCTCCCATCACAGGCCTGGAGG + Intergenic
981275761 4:142897415-142897437 TCAGCCCACCACTGCACTGTGGG + Intergenic
981356916 4:143799415-143799437 CCCTCCCATCACAGGCCTGGAGG - Intergenic
981861447 4:149361433-149361455 CCCTCCCATCACAGGCCTGGAGG + Intergenic
982162843 4:152587270-152587292 CCCTCCCATCACAGACCTGGAGG + Intergenic
982408162 4:155044219-155044241 TCAGCCCACCACTGCACTGTGGG + Intergenic
982828710 4:160031940-160031962 CCAGCCCCCCACTGCCCTACGGG + Intergenic
982829604 4:160043462-160043484 CCCTCCCATCACAGGCCTGGAGG - Intergenic
982917260 4:161227699-161227721 CCCTCCCATCACAGGCCTGGAGG - Intergenic
983369825 4:166843233-166843255 TCAGCCCACCTCTGCCCTGTGGG - Intronic
983657553 4:170098431-170098453 CCCTCCCATCACAGGCCTGGAGG - Intergenic
983968482 4:173843483-173843505 CCCTCCCACCACAGGACTGGAGG + Intergenic
984265592 4:177495508-177495530 TCAGCCCACCACTGCACTGTGGG + Intergenic
984699851 4:182811864-182811886 CCCTCCCATCACAGGCCTGGAGG - Intergenic
984776173 4:183483108-183483130 TCAGCCCACCACTGCACTGTGGG - Intergenic
984811167 4:183797574-183797596 CGCGGCCAGCCCTGCCCTGGGGG + Intergenic
985220267 4:187696783-187696805 CCCTCCCATCACAGGCCTGGAGG + Intergenic
985371699 4:189292149-189292171 CCCTCCCATCACAGGCCTGGAGG + Intergenic
985409228 4:189665185-189665207 TCAGCCCACCACTGCACTGTAGG - Intergenic
985520537 5:372175-372197 CCAGCCCACCCCAGCCCTGGGGG - Intronic
985558776 5:571009-571031 CCCGCACACCTGTGCCCAGGTGG + Intergenic
985809137 5:2070426-2070448 CCCTCCCATCACAGGCCTGGAGG + Intergenic
986022931 5:3821727-3821749 CCTGCTCACCTGTGCCCTGGGGG + Intergenic
986506537 5:8457806-8457828 CCCGCCTAGCACTGGCCTGATGG + Intergenic
986697935 5:10375074-10375096 TCAGCCCACCACTGCACTGTGGG + Intronic
986780178 5:11058245-11058267 ACCTCCCACCACAGGCCTGGAGG + Intronic
986963535 5:13244120-13244142 TCAGCCCACCACTGCACTGTGGG + Intergenic
987000023 5:13651220-13651242 CCCACCCATCACAGGCCTGGAGG + Intergenic
987201759 5:15584189-15584211 CCCTCCCATCACAGGCCTGGAGG - Intronic
987545952 5:19310138-19310160 CCCTCCCATCACAGGCCTGGAGG - Intergenic
988074823 5:26338933-26338955 CCCTCCCATCACAGGCCTGGAGG - Intergenic
988132097 5:27119813-27119835 TCAGCCCACCACTGCACTGAGGG + Intronic
988369180 5:30345644-30345666 TCAGCCCACCACTGCACTGTGGG + Intergenic
988394398 5:30679085-30679107 CCCTCCCATCACAGGCCTGGAGG + Intergenic
988605988 5:32678719-32678741 TCAGCCCACCACTGCACTGTGGG - Intergenic
989067844 5:37481623-37481645 CCCTCCCATCACAGGCCTGGAGG - Intronic
989750310 5:44884369-44884391 TCAGCCCACCACTGCGCTGTGGG - Intergenic
989787120 5:45345282-45345304 CCCTCCCATCACAGACCTGGAGG - Intronic
990075795 5:51844135-51844157 CCCTCCCATCACAGACCTGGAGG - Intergenic
990077787 5:51872928-51872950 CCCTCCCACCACAGTTCTGGAGG + Intergenic
990291209 5:54354065-54354087 CCCTCCCATCACAGGCCTGGAGG + Intergenic
990526030 5:56628798-56628820 CCCTCCCATCACAGGCCTGGAGG + Intergenic
991116895 5:62964642-62964664 CCCTCCCATCACAGGCCTGGAGG - Intergenic
991122500 5:63032466-63032488 CCCTCCCATCACAGGCCTGGAGG + Intergenic
991340369 5:65601967-65601989 CCCTCCCATCACAGGCCTGGAGG - Intronic
991355798 5:65767509-65767531 CCCTCCCATCACAGGCCTGGAGG - Intronic
992215798 5:74523838-74523860 CCCTCCCATCACAGGCCTGGAGG + Intergenic
992296674 5:75333601-75333623 CCCCCCCTCCACTGCACTGTGGG + Intergenic
992365477 5:76084811-76084833 CCCGCCCCCCTCTGCCCCGCCGG - Intronic
992897156 5:81255115-81255137 CGTGGCCATCACTGCCCTGGAGG + Exonic
993024120 5:82626557-82626579 CCTTCCCATCACAGCCCTGGAGG + Intergenic
993285470 5:85990938-85990960 CCCTCCCATCACAGGCCTGGAGG + Intergenic
994043358 5:95283768-95283790 CCCGCCCCCCGCTCCCCGGGTGG + Intronic
994320179 5:98386275-98386297 CACGGCCACCACTGCCCATGTGG + Intergenic
994425158 5:99576339-99576361 CCCTCCCATCACAGGCCTGGAGG + Intergenic
994436180 5:99735894-99735916 CCCTCCCATCACAGGCCTGGAGG - Intergenic
994509903 5:100689311-100689333 TCAGCCCACCACTGCACTGTGGG - Intergenic
994580315 5:101632964-101632986 CCCTCCCATCACAGGCCTGGAGG - Intergenic
994656001 5:102593611-102593633 CCCTCCCATCACAGGCCTGGAGG - Intergenic
994769847 5:103966769-103966791 TCAGCCCACCACTGCACTGTGGG - Intergenic
994781556 5:104095794-104095816 CCCTCCCACCACTGGCCCAGAGG - Intergenic
994835609 5:104848639-104848661 CTAGCCCCCCACTGCCCTAGAGG + Intergenic
994936017 5:106254973-106254995 CCCTCCCATCACAGGCCTGGGGG + Intergenic
995055363 5:107753578-107753600 CCCTCCCATCACAGGCCTGGAGG + Intergenic
995370180 5:111409484-111409506 CCCTCCCATCACAGGCCTGGAGG - Intronic
995529081 5:113074972-113074994 TCAGCCCACCACTGCACTGTGGG + Intronic
995700309 5:114928765-114928787 TCAGCCCACCACTGCACTGTGGG + Intergenic
996030974 5:118703453-118703475 CCCTCCCATCACAGGCCTGGAGG - Intergenic
996435627 5:123430463-123430485 TCAGCCCACCACTGCACTGTGGG + Intergenic
996478758 5:123949632-123949654 TCAGCCCACCACTGCACTGTGGG - Intergenic
996605278 5:125313806-125313828 CCCTCCCATCACAGGCCTGGAGG - Intergenic
996670557 5:126112998-126113020 CCCTCCCATCACAGGCCTGGAGG + Intergenic
997016263 5:129938277-129938299 CCCTCCCATCACAGGCCTGGAGG - Intronic
997081664 5:130746801-130746823 CCCTCCCATCACAGGCCTGGAGG + Intergenic
997108281 5:131046146-131046168 CCCTCCCATCACAGGCCTGGAGG - Intergenic
997181460 5:131832920-131832942 CCCTCCCATCACAGGCCTGGAGG - Intronic
997182349 5:131843207-131843229 CCCTCCCATCACAGGCCTGGAGG - Intronic
997760495 5:136444129-136444151 TCAGCCCACCACTGCACTGTGGG + Intergenic
998813980 5:145993752-145993774 CCCTCCCATCACAGGCCTGGAGG - Intronic
999322558 5:150624604-150624626 CCCGCCCCGCCCAGCCCTGGGGG - Intronic
1000085804 5:157886772-157886794 TCAGCCCACCACTGCACTGTGGG + Intergenic
1000329253 5:160194351-160194373 TCAGCCCACCACTGCACTGTGGG - Intronic
1000777922 5:165442409-165442431 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1002187299 5:177460276-177460298 TCCGCCCACCACTTCCCAGGTGG - Intronic
1002278644 5:178118555-178118577 TCCACCCACCACTGCCCAGACGG + Intronic
1002465132 5:179404582-179404604 GGCACACACCACTGCCCTGGAGG + Intergenic
1002556579 5:180046284-180046306 TCAGCCCACCACTGCACTGTGGG - Intronic
1002789441 6:426644-426666 TCAGCCCACCACTGCACTGTGGG - Intergenic
1002907086 6:1457413-1457435 TCAGCCCACCACTGCACTGTGGG - Intergenic
1003484469 6:6563571-6563593 CCCCCCCATCACAGGCCTGGAGG - Intergenic
1003552139 6:7108881-7108903 CACGCCGACCACCGCCCCGGGGG + Intronic
1003869341 6:10389952-10389974 CCCGCCTCCCTCGGCCCTGGCGG - Intergenic
1003947215 6:11087133-11087155 TCAGCCCACCACTGCACTGTGGG + Intergenic
1004912574 6:20301178-20301200 TCAGCCCACCACTGCACTGTGGG + Intergenic
1005153558 6:22779209-22779231 CCCTCTCACCACAGGCCTGGGGG + Intergenic
1005600937 6:27425272-27425294 TCAGCCCACCACTGCACTGTGGG - Intergenic
1005758956 6:28950237-28950259 TCAGCCCACCACTGCACTGTGGG - Intergenic
1005900754 6:30214466-30214488 CCCTCTCACCACTGCCTAGGCGG - Intergenic
1005977070 6:30807886-30807908 TCAGCCCACCACTGCACTGTGGG - Intergenic
1005982943 6:30851522-30851544 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1006217028 6:32453340-32453362 CCTGCCCATCACAGGCCTGGAGG + Intergenic
1006344110 6:33466233-33466255 CCCTCCCATCACAGTCCTGGAGG + Intergenic
1006850212 6:37092858-37092880 CCCACCCACCACTGTTCTGGGGG + Intergenic
1007781769 6:44258406-44258428 AGCCCTCACCACTGCCCTGGGGG - Exonic
1008220913 6:48852463-48852485 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1008261043 6:49366770-49366792 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1008756086 6:54797077-54797099 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1008770933 6:54979152-54979174 TCAGCCCACCACTGCACTGTGGG + Intergenic
1008859619 6:56133636-56133658 CCCTCCCATCACAGGCCTGGAGG + Intronic
1009346059 6:62614111-62614133 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1009527433 6:64764521-64764543 CCCTCCCATCACAGGCCTGGAGG - Intronic
1009739225 6:67722969-67722991 TCAGCCCACCACTGCACTGTGGG + Intergenic
1009792339 6:68419861-68419883 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1009800664 6:68533350-68533372 TCAGCCCACCACTGCACTGTGGG + Intergenic
1009873115 6:69472998-69473020 TCAGCCCACCACTGCACTGTGGG + Intergenic
1010263702 6:73844844-73844866 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1010270315 6:73909904-73909926 TCAGCCCACCACTGCACTGTGGG + Intergenic
1010611824 6:77962861-77962883 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1010645889 6:78387080-78387102 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1010651071 6:78455845-78455867 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1010735901 6:79443325-79443347 CCCTCCCATCACAGACCTGGAGG - Intergenic
1010978374 6:82341568-82341590 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1011041113 6:83031726-83031748 CCCTCCCATCACAGGCCTGGAGG + Intronic
1011110582 6:83833450-83833472 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1011353834 6:86453418-86453440 CCCTCCCACAACAGGCCTGGAGG + Intergenic
1011601553 6:89064940-89064962 TCAGCCCACCACTGCACTGTGGG + Intergenic
1011870087 6:91882115-91882137 TCAGCCCACCACTGCACTGTGGG - Intergenic
1012019913 6:93905319-93905341 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1012070264 6:94604937-94604959 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1012141454 6:95631434-95631456 CCCTCCCAACACAGGCCTGGAGG + Intergenic
1012723818 6:102783554-102783576 CCCTCCCATCACAGACCTGGAGG + Intergenic
1012760565 6:103294847-103294869 TCAGCCCACCACTGCACTGTGGG - Intergenic
1012762243 6:103317290-103317312 CCCTCCCACCACAGGCCTGGAGG + Intergenic
1012823808 6:104123446-104123468 CCCTCCCATCACAGACCTGGAGG + Intergenic
1013076974 6:106780521-106780543 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1013086598 6:106863006-106863028 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1013149007 6:107426104-107426126 CCCTCCCATCACAGGCCTGGAGG + Intronic
1013338625 6:109191521-109191543 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1013415051 6:109917540-109917562 GCCACCCACCCCTGCCTTGGTGG + Intergenic
1013688045 6:112609077-112609099 CCCTCCTACCACAGGCCTGGAGG + Intergenic
1013829580 6:114255850-114255872 CCCTCCCAGCACAGGCCTGGAGG - Intronic
1014342643 6:120228495-120228517 CCCTCCCATCACAGACCTGGAGG - Intergenic
1014407421 6:121068902-121068924 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1014562978 6:122913699-122913721 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1014691640 6:124570399-124570421 CCCTCCCATCACAGTCCTGGAGG + Intronic
1014714513 6:124848911-124848933 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1014718503 6:124891889-124891911 TCAGCCCACCACTGCACTGTGGG + Intergenic
1014771120 6:125458707-125458729 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1015130428 6:129803219-129803241 CCCTCCCATCACTGGCCAGGAGG + Intergenic
1015502128 6:133945316-133945338 CACCCCCACCTCTGCCCTGTCGG - Intergenic
1015845812 6:137519733-137519755 CCCCCCCGCCCCTGCCATGGTGG + Intergenic
1016094682 6:140020701-140020723 CCCTCCCATCACAGCCCTGGAGG - Intergenic
1016177552 6:141099026-141099048 CCCTCCCACCACAGGCTTGGAGG + Intergenic
1016838580 6:148504230-148504252 CATGCCCATCACTGCCCTGATGG - Intronic
1017547593 6:155468519-155468541 CCCTCCCACCACATGCCTGGAGG - Intergenic
1018064300 6:160114945-160114967 TCAGCCCACCACTGCACTGTGGG - Intergenic
1018516155 6:164581807-164581829 CCCGTCCATCACAGGCCTGGAGG - Intergenic
1018802776 6:167236374-167236396 CCCTCCACCCGCTGCCCTGGGGG - Intergenic
1019150467 6:170002021-170002043 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1019165960 6:170097712-170097734 CCCGCCCGCCACTCTCTTGGTGG - Intergenic
1019305458 7:332510-332532 CCCGCTCACCCCTGCCCCTGGGG - Intergenic
1019317816 7:398556-398578 CCCTCACATCACTGTCCTGGTGG + Intergenic
1019414748 7:922120-922142 CCCGACTCCCACAGCCCTGGAGG + Intronic
1019793652 7:3033814-3033836 CCCTCCTCCCACTGCACTGGTGG - Intronic
1020100048 7:5389379-5389401 CCCTCCCACCCCTGCCTGGGCGG + Intronic
1020281469 7:6652392-6652414 GCCGCCGACCAGAGCCCTGGGGG - Exonic
1020407735 7:7855626-7855648 TCCTCCCACCACAGGCCTGGAGG - Intronic
1020611346 7:10401518-10401540 CCCTCCCATCACGGGCCTGGAGG - Intergenic
1021082926 7:16384795-16384817 CCCTCCCACCCCATCCCTGGAGG - Intronic
1021646793 7:22796643-22796665 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1022121702 7:27314656-27314678 CACACCCTCCACTGCCCTGGAGG + Intergenic
1022339488 7:29455059-29455081 CCTGCCTACCCCTGCCCTGAAGG - Intronic
1022750370 7:33218890-33218912 TCAGCCCACCACTGCACTGTGGG + Intronic
1023089094 7:36601058-36601080 GGCGCACACCACTGCTCTGGAGG + Intronic
1023188593 7:37555707-37555729 CCCACCCATCACAGGCCTGGAGG - Intergenic
1023984461 7:45086805-45086827 CCTGCCCACCACTGCCCTTGTGG - Intronic
1024207516 7:47176747-47176769 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1024269012 7:47628393-47628415 TCAGCCCACCACTGCACTGTGGG + Intergenic
1024335702 7:48203360-48203382 TCAGCCCACCACTGCACTGTGGG - Intronic
1024487121 7:49931784-49931806 CCCTCCCATCACAGGCCTGGAGG + Intronic
1024683231 7:51716655-51716677 TGCACCCACCACTGCCCCGGGGG - Intergenic
1024833981 7:53494937-53494959 CCAGCCCACCACTGCACTGTGGG + Intergenic
1025038517 7:55619059-55619081 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1025928955 7:65980090-65980112 CCTGCCCTGCCCTGCCCTGGGGG - Intronic
1026990715 7:74583852-74583874 ACCGCTCACAACTGCCTTGGAGG + Intronic
1027586730 7:80066855-80066877 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1027667593 7:81057920-81057942 TCAGCCCACCACTGCACTGTGGG - Intergenic
1027831523 7:83183129-83183151 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1028140996 7:87274508-87274530 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1028207186 7:88031725-88031747 CCCTCCCATCACAGGCCTGGAGG + Intronic
1028516321 7:91681250-91681272 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1029567448 7:101348491-101348513 TCAGCCCACCACTGCACTGGGGG + Intergenic
1030357364 7:108557154-108557176 CCCTCCCATCACAGGCCTGGAGG - Intronic
1030527695 7:110673366-110673388 CCCTCCCATCACAGGCCTGGAGG - Intronic
1030986250 7:116245054-116245076 CCCTCCCATCACAGGCCTGGAGG - Intronic
1031292321 7:119951954-119951976 TCAGCCCACCACTGCACTGTGGG - Intergenic
1031409151 7:121421625-121421647 TCAGCCCACCACTGCACTGTGGG + Intergenic
1031573071 7:123383264-123383286 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1031608195 7:123794430-123794452 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1032248010 7:130229938-130229960 TCAGCCCACCACTGCCCTGTGGG + Intergenic
1032318225 7:130860986-130861008 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1032386934 7:131531654-131531676 CCCGCCAACCTCTGCCCTCATGG + Intronic
1033419770 7:141195069-141195091 CCCTCCCATCACAGGCCTGGAGG - Intronic
1033760035 7:144427763-144427785 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1033998778 7:147386194-147386216 CCCTCCCATCACAGGCCTGGAGG - Intronic
1034011279 7:147531649-147531671 CCCTCCCATCACAGGCCTGGAGG - Intronic
1034167817 7:149039141-149039163 TCAGCCCACCACTGCACTGTGGG - Intergenic
1034303585 7:150035209-150035231 GCCTCCCACCTCTGCCATGGGGG + Intergenic
1034636990 7:152575466-152575488 CCCACCCACATCTGCCCTGGGGG + Intergenic
1034751837 7:153576259-153576281 CCCTCCCACCACAGGCCTGGAGG + Intergenic
1034876196 7:154726590-154726612 CCCTCCCATCACAGGCCTGGAGG - Intronic
1035330537 7:158094214-158094236 CCGGCCCACCCCTGTGCTGGGGG - Intronic
1035549519 8:509638-509660 CCCTCCCATCACAGGCCTGGAGG - Intronic
1035665538 8:1377173-1377195 GCTGCACACCACTGACCTGGAGG - Intergenic
1035683628 8:1507556-1507578 TCAGCCAGCCACTGCCCTGGGGG - Intronic
1035689213 8:1548823-1548845 CCCGCCGACAGCTGCCCCGGGGG + Exonic
1035951857 8:4030584-4030606 CCCTCCCATCACAGGCCTGGAGG - Intronic
1037003411 8:13747913-13747935 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1037213898 8:16425723-16425745 CCCTCCCATCACAGGCCTGGAGG + Intronic
1037517336 8:19645830-19645852 CCAGGCCAGCACTGCCCTGGGGG - Intronic
1037834735 8:22209313-22209335 CCCACCCATCACTGGCCTCGTGG + Intronic
1037906836 8:22720412-22720434 CCTGCCCACCACTGCCCATCTGG - Intronic
1037983463 8:23272034-23272056 TCAGCCCACCACTGCACTGTGGG + Intronic
1038847664 8:31244550-31244572 TCAGCCCACCACTGCACTGTGGG - Intergenic
1039071336 8:33651900-33651922 CCCTCCCACCACAGGCTTGGAGG + Intergenic
1039121900 8:34157270-34157292 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1040286009 8:46100751-46100773 CCCACCCAGGACAGCCCTGGGGG + Intergenic
1040289356 8:46116478-46116500 CCTGCCCAAGACAGCCCTGGGGG + Intergenic
1040295380 8:46146310-46146332 CCCGCCCATGACAGCCCTAGGGG + Intergenic
1040301220 8:46188990-46189012 CCTGCCCACAACAGCCCTGGAGG - Intergenic
1040304164 8:46203428-46203450 CCCGTCCAGTACAGCCCTGGGGG - Intergenic
1040308622 8:46225137-46225159 CACGCCCAGGACAGCCCTGGGGG - Intergenic
1040312299 8:46243085-46243107 CCCTCCCCAGACTGCCCTGGGGG - Intergenic
1040312349 8:46243302-46243324 CCTGCCCAGCGCAGCCCTGGGGG - Intergenic
1040312759 8:46245238-46245260 CCCGCCCGGGACAGCCCTGGGGG - Intergenic
1040314427 8:46253501-46253523 CCCGCCCAGGACAGTCCTGGTGG - Intergenic
1040315044 8:46256540-46256562 CCCACCCAGGACAGCCCTGGGGG - Intergenic
1040315126 8:46256973-46256995 CCCGCCCGGGACAGCCCTGGGGG - Intergenic
1040316405 8:46263207-46263229 CTCGCCCAGGACAGCCCTGGGGG - Intergenic
1040332258 8:46391644-46391666 CCTGCCCAGGACAGCCCTGGGGG - Intergenic
1040336486 8:46418657-46418679 CCCGCCCAGGACAGCCCTGAGGG - Intergenic
1040336831 8:46420352-46420374 CCCGCCCCAGACAGCCCTGGGGG - Intergenic
1040338920 8:46430108-46430130 CCCGCCCGGGACAGCCCTGGGGG - Intergenic
1040338971 8:46430325-46430347 CCCGCCCAGGACACCCCTGGGGG - Intergenic
1040341557 8:46443669-46443691 CCAGCCCAGGACAGCCCTGGGGG + Intergenic
1040342068 8:46446130-46446152 CCCGCATGCGACTGCCCTGGGGG + Intergenic
1040813366 8:51481582-51481604 TCCTCCCATCACTGGCCTGGAGG + Intronic
1040952770 8:52953301-52953323 CCCCCCCCCCACTGCACTGTGGG - Intergenic
1041013796 8:53571009-53571031 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1041369433 8:57143369-57143391 CCGGCCCACCCCGGCCCCGGCGG - Intergenic
1042602486 8:70512388-70512410 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1042646126 8:70988103-70988125 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1043110056 8:76169525-76169547 TCAGCCCACCACTGCACTGTGGG + Intergenic
1043426058 8:80150022-80150044 CCCTCCCATCACAGGCCTGGAGG + Intronic
1043518510 8:81019382-81019404 CCCTCCCATCACAGGCCTGGAGG + Intronic
1044066611 8:87706501-87706523 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1044303889 8:90616375-90616397 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1044324881 8:90847887-90847909 CCCTCCCATCACAGGCCTGGAGG - Intronic
1044420850 8:91994131-91994153 CCTGGCCACCACTCCCTTGGGGG - Intronic
1044862212 8:96534254-96534276 TCAGCCCACCACTGCACTGTGGG - Intronic
1045050540 8:98320230-98320252 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1045053651 8:98349889-98349911 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1045354873 8:101376651-101376673 ACCAGCCACCACTGCCCTTGTGG - Intergenic
1045604804 8:103760479-103760501 CTCACCCAGCACTGCCATGGTGG - Intronic
1045617934 8:103939494-103939516 CCCTCCCATCACAGGCCTGGAGG - Intronic
1046226384 8:111285764-111285786 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1046606091 8:116373670-116373692 CCCTCCCAGCACAGACCTGGGGG - Intergenic
1046735116 8:117768556-117768578 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1048668383 8:136689759-136689781 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1048710207 8:137201435-137201457 CCACCCCACCACTCCCATGGTGG + Intergenic
1049076257 8:140398877-140398899 CCCTCCCATCACAGGCCTGGAGG + Intronic
1049436648 8:142589238-142589260 CCTGGCCAGCACTGCCCGGGGGG - Intergenic
1049889204 9:52496-52518 ACAGCCAGCCACTGCCCTGGAGG - Intergenic
1050294849 9:4195214-4195236 TCAGCCCACCACTGCACTGTGGG + Intronic
1050674574 9:8037124-8037146 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1051437728 9:17051141-17051163 CCTGCACAGCACTGACCTGGGGG - Intergenic
1051463736 9:17353851-17353873 TCAGCCCACCACTGCACTGTGGG + Intronic
1051720636 9:20033665-20033687 CACTCCCACCAGTGCCCTGACGG + Intergenic
1051767507 9:20540682-20540704 CCCTCCCATCACTGGCCTGGAGG - Intronic
1051914991 9:22198007-22198029 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1052056725 9:23914858-23914880 TCAGCCCACCACTGCACTGTGGG - Intergenic
1052294520 9:26882286-26882308 CCCTCCCATCACAGGCCTGGAGG + Intronic
1052540875 9:29810484-29810506 CCCTCCCACCACAGGCCAGGTGG + Intergenic
1052625040 9:30963255-30963277 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1052702224 9:31950938-31950960 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1052985596 9:34484925-34484947 CCTGGCCACCTCTGCCCTGGGGG - Intronic
1053027350 9:34740681-34740703 TCAGCCCACCACTGCACTGTGGG - Intergenic
1053089792 9:35264665-35264687 CCCCCTCACCACAGACCTGGGGG + Intronic
1053616432 9:39770802-39770824 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1053730689 9:41053781-41053803 ACAGCCAGCCACTGCCCTGGAGG - Intergenic
1054237085 9:62571587-62571609 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1054551224 9:66606098-66606120 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1054697812 9:68378295-68378317 ACAGCCAGCCACTGCCCTGGAGG + Exonic
1054797200 9:69313406-69313428 CCCTCCCATCACAGGCCTGGGGG - Intergenic
1055083489 9:72290632-72290654 CCCTCCCATCACAGACCTGGAGG - Intergenic
1055102635 9:72480646-72480668 TCAGCCCACCACTGCACTGTGGG - Intergenic
1055141942 9:72886532-72886554 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1055174467 9:73299948-73299970 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1055557644 9:77490827-77490849 TCAGCCCACCACTGCACTGTGGG - Intronic
1055582429 9:77721284-77721306 CCCGCCCTGCCCTTCCCTGGTGG - Exonic
1056012416 9:82346186-82346208 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1056064229 9:82916474-82916496 CCTGCCCATCACAGGCCTGGAGG - Intergenic
1056527361 9:87455638-87455660 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1056556691 9:87695402-87695424 GCCGCCCACCACTGGCCTCTGGG - Intronic
1056731052 9:89167088-89167110 CCAGCACACCCCTGCCCTGGGGG + Intronic
1057645053 9:96866200-96866222 CCCTCCCATCACAGGCCTGGAGG + Intronic
1057907248 9:98992550-98992572 TCAGCCCACCACTGCACTGTGGG - Intronic
1058286503 9:103186829-103186851 TCAGCCCACCACTGCACTGTGGG + Intergenic
1058786434 9:108393421-108393443 TCAGCCCACCACTGCACTGTGGG + Intergenic
1059187019 9:112283743-112283765 CCCTCCCATCACAGACCTGGAGG + Intronic
1059587301 9:115619914-115619936 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1059991628 9:119870727-119870749 TCAGCCCACCACTGCACTGTGGG - Intergenic
1060186416 9:121566752-121566774 CCCCCCAACCCCTCCCCTGGGGG + Intergenic
1060622664 9:125082073-125082095 CCCTCCCATCACAGGCCTGGAGG + Intronic
1061887468 9:133599044-133599066 CCCTTGCACCCCTGCCCTGGGGG + Intergenic
1062146276 9:134991476-134991498 TCAGCCCACCACTGCTCTGTGGG - Intergenic
1062321442 9:135992413-135992435 ACGGCTCACCCCTGCCCTGGGGG + Intergenic
1062421936 9:136486823-136486845 ACTGCCCACCATGGCCCTGGGGG - Intergenic
1062438730 9:136559460-136559482 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1062449405 9:136609241-136609263 CCCGCCTGGCCCTGCCCTGGGGG - Intergenic
1062609397 9:137367208-137367230 CCTGCCCAGCAGTGCCTTGGGGG + Intronic
1062670057 9:137703205-137703227 CCCTCCCATCACAGGCCTGGAGG - Intronic
1203467450 Un_GL000220v1:100714-100736 CCCCCCCACCACCGCCTTGGTGG + Intergenic
1186434223 X:9529243-9529265 CCCACCCAAGTCTGCCCTGGTGG - Intronic
1186700249 X:12083134-12083156 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1186742565 X:12534000-12534022 CCCTCCCATCACAGGCCTGGAGG + Intronic
1187072404 X:15901259-15901281 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1187903948 X:24049607-24049629 TCAGCCCACCACTGCACTGTGGG + Intergenic
1188196351 X:27240203-27240225 CCCGCCCATCACAGGCCTAGAGG + Intergenic
1188449528 X:30294807-30294829 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1189071349 X:37866881-37866903 CCCTCCCATCACAGGCCTGGAGG - Intronic
1190414032 X:50163775-50163797 TCAGCCCACCACTGCACTGTGGG - Intergenic
1191052339 X:56207157-56207179 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1191116467 X:56857989-56858011 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1191595179 X:62935916-62935938 CCCACCCCCCATTGCCCTTGGGG - Intergenic
1191688153 X:63913878-63913900 CCCTCCCATCACAGGCCTGGTGG + Intergenic
1191696540 X:63996419-63996441 CCCTCCCGCCACAGGCCTGGAGG + Intergenic
1192309382 X:69997655-69997677 CCCTCCCATCACAGGCCTGGAGG + Intronic
1192502056 X:71660830-71660852 CACCCCTATCACTGCCCTGGGGG - Intergenic
1192869727 X:75174043-75174065 TCAGCCCACCACTGCACTGTGGG - Intergenic
1192870633 X:75179963-75179985 TCAGCCCACCACTGCACTGTGGG - Intergenic
1193043836 X:77031881-77031903 TCCCTCCACCAGTGCCCTGGTGG + Intergenic
1193188338 X:78539342-78539364 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1193221271 X:78929304-78929326 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1193250245 X:79281997-79282019 CTCTCCCATCACAGCCCTGGAGG - Intergenic
1193406393 X:81107192-81107214 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1193506274 X:82348333-82348355 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1193529897 X:82643422-82643444 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1193759229 X:85443473-85443495 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1193850450 X:86531344-86531366 CCCTCCCATCACAGACCTGGAGG + Intronic
1193938538 X:87652214-87652236 CCCTCCCATCACAGGCCTGGAGG - Intronic
1194082953 X:89490412-89490434 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1194145360 X:90255093-90255115 CCCTCCCATCACAGACCTGGAGG - Intergenic
1194216352 X:91134590-91134612 CCCTCCCATCACAGGCCTGGCGG + Intergenic
1194244438 X:91493651-91493673 CCCTCCCATCACAGCCCTGGAGG - Intergenic
1194876917 X:99201034-99201056 CCCTCCCATCACAGTCCTGGAGG + Intergenic
1195108490 X:101623191-101623213 CCAGCTCCCCACTGCCCTGAGGG + Exonic
1195210132 X:102646373-102646395 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1195228091 X:102818492-102818514 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1195814262 X:108867951-108867973 CCCTCCCATCACAGACCTGGAGG - Intergenic
1195863664 X:109407583-109407605 CCCTCCCATCACAGGCCTGGAGG + Intronic
1196173601 X:112616739-112616761 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1196278511 X:113796541-113796563 CCCTCCCATCACAGGCCTGGGGG + Intergenic
1196566102 X:117206824-117206846 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1196605691 X:117654721-117654743 CCCTCCCATCACAGCCCTGGAGG - Intergenic
1196741453 X:119029429-119029451 TCAGCCCACCACTGCACTGTGGG + Intergenic
1196775435 X:119333511-119333533 TGAGCCCACCACTGCCCTGTGGG + Intergenic
1196781530 X:119388030-119388052 TCAGCCCACCACTGCACTGTGGG - Intergenic
1196844990 X:119890516-119890538 TCAGCCCACCACTGCACTGTGGG + Intergenic
1196973916 X:121138172-121138194 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1197004497 X:121480356-121480378 CCCTCCCACCAAAGCCCTGGAGG + Intergenic
1197223088 X:123932201-123932223 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1197639794 X:128954904-128954926 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1197642844 X:128985948-128985970 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1198327300 X:135586544-135586566 CACTGCCACCACTGCCCTGGTGG + Intergenic
1198664375 X:139004471-139004493 TCAGCCCACCACTGCACTGTGGG - Intronic
1198693256 X:139307445-139307467 CCCTCCCATCACAGACCTGGAGG + Intergenic
1198919401 X:141708562-141708584 CCCTCCCAACACAGACCTGGAGG - Intergenic
1199070446 X:143469348-143469370 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1199106537 X:143875581-143875603 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1199117443 X:144008901-144008923 CCCTCCCATCACAGCCCTGGAGG - Intergenic
1199175470 X:144783548-144783570 TCAGCCCACCACTGCACTGTGGG + Intergenic
1199220583 X:145311400-145311422 CCCTCCCATCACGGGCCTGGAGG - Intergenic
1199346541 X:146747157-146747179 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1199389364 X:147261986-147262008 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1199462606 X:148101026-148101048 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1199472478 X:148210288-148210310 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1200295417 X:154914270-154914292 CCCTCCCATCACAGGCCTGGAGG - Intronic
1200435604 Y:3146285-3146307 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1200491122 Y:3824391-3824413 CCCTCCCATCACAGACCTGGAGG - Intergenic
1200563416 Y:4734948-4734970 CCCTCCCATCACAGCCCTGGAGG - Intergenic
1202109774 Y:21407116-21407138 TCGGCCCACCACTGCACTGTGGG + Intergenic