ID: 1160155978

View in Genome Browser
Species Human (GRCh38)
Location 18:76434058-76434080
Sequence TCCAGCTGGTCAGGAACTGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 400
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 366}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160155968_1160155978 19 Left 1160155968 18:76434016-76434038 CCCAACCCAGCACCTGCTGCTCT 0: 1
1: 0
2: 10
3: 68
4: 489
Right 1160155978 18:76434058-76434080 TCCAGCTGGTCAGGAACTGACGG 0: 1
1: 0
2: 3
3: 30
4: 366
1160155967_1160155978 24 Left 1160155967 18:76434011-76434033 CCTTACCCAACCCAGCACCTGCT 0: 1
1: 0
2: 8
3: 42
4: 486
Right 1160155978 18:76434058-76434080 TCCAGCTGGTCAGGAACTGACGG 0: 1
1: 0
2: 3
3: 30
4: 366
1160155971_1160155978 14 Left 1160155971 18:76434021-76434043 CCCAGCACCTGCTGCTCTGGCCG 0: 1
1: 0
2: 1
3: 43
4: 328
Right 1160155978 18:76434058-76434080 TCCAGCTGGTCAGGAACTGACGG 0: 1
1: 0
2: 3
3: 30
4: 366
1160155972_1160155978 13 Left 1160155972 18:76434022-76434044 CCAGCACCTGCTGCTCTGGCCGT 0: 1
1: 0
2: 2
3: 31
4: 365
Right 1160155978 18:76434058-76434080 TCCAGCTGGTCAGGAACTGACGG 0: 1
1: 0
2: 3
3: 30
4: 366
1160155974_1160155978 -6 Left 1160155974 18:76434041-76434063 CCGTTGCTGTCCGTTCTTCCAGC 0: 1
1: 0
2: 1
3: 15
4: 175
Right 1160155978 18:76434058-76434080 TCCAGCTGGTCAGGAACTGACGG 0: 1
1: 0
2: 3
3: 30
4: 366
1160155969_1160155978 18 Left 1160155969 18:76434017-76434039 CCAACCCAGCACCTGCTGCTCTG 0: 1
1: 0
2: 4
3: 61
4: 573
Right 1160155978 18:76434058-76434080 TCCAGCTGGTCAGGAACTGACGG 0: 1
1: 0
2: 3
3: 30
4: 366
1160155973_1160155978 7 Left 1160155973 18:76434028-76434050 CCTGCTGCTCTGGCCGTTGCTGT 0: 1
1: 0
2: 2
3: 37
4: 279
Right 1160155978 18:76434058-76434080 TCCAGCTGGTCAGGAACTGACGG 0: 1
1: 0
2: 3
3: 30
4: 366

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160155978 Original CRISPR TCCAGCTGGTCAGGAACTGA CGG Intronic
900606213 1:3524720-3524742 TCCAGATGGCCATGAACTGCGGG - Intronic
901413251 1:9099748-9099770 TCCTGGTGGTCAGGGACTGCTGG - Intergenic
901581694 1:10249690-10249712 TCCAGCTGGTCTCGAACTCCTGG - Intronic
901957346 1:12796168-12796190 TCCAGCTGGTCTCAAACTGCTGG + Exonic
901973741 1:12928420-12928442 CCCAGCTGGTCTGAAACTGCTGG + Intronic
902011437 1:13273347-13273369 CCCAGCTGGTCTGAAACTGCTGG - Intergenic
902510935 1:16966567-16966589 GCCAGGTGGGCAGGAGCTGAGGG + Exonic
903009494 1:20319838-20319860 TCCAGGAGGTAAGGAGCTGAAGG - Intronic
903041887 1:20536882-20536904 TCCTGTGGGTCAGGAACTCAAGG - Intergenic
903229848 1:21915032-21915054 TCCGCCTGGTCAGGAACATAAGG - Intronic
903642124 1:24867406-24867428 TACAGCGGGTGAGGAACAGAAGG + Intergenic
904529593 1:31159567-31159589 TCCAGCTGCTCAGGAGATTAAGG + Intergenic
904865482 1:33575455-33575477 GCCAGCTGGGTAGGGACTGAGGG + Intronic
905117260 1:35653144-35653166 TCCGGCTGGTCTGGAACTCCTGG + Intergenic
905244163 1:36601163-36601185 TCCAGCAGGGCAGGCACTCATGG - Intergenic
905648523 1:39640721-39640743 GCCACCAGGTCAGGACCTGAGGG + Intergenic
906129663 1:43448477-43448499 CCCAGCTGGTAAGGAACTGTGGG + Exonic
906525118 1:46489359-46489381 TGCAGGTGGTGTGGAACTGATGG + Intergenic
906547773 1:46633762-46633784 ACCAGCGGGTGAGGAAATGATGG - Exonic
907626007 1:56030309-56030331 TCCAGATGGTAAGGATGTGAAGG - Intergenic
907666491 1:56437586-56437608 TCCATGTGGTCACGACCTGAAGG - Intergenic
910745682 1:90571721-90571743 TCAAGCTGGTCTTGAACTGCTGG - Intergenic
911041153 1:93592041-93592063 TCCACATGTTCAGGAAGTGAAGG - Intronic
912998159 1:114552407-114552429 TCCATGTGGCAAGGAACTGAGGG - Intergenic
914441946 1:147715450-147715472 TCCAGGAGGTGAGGAACTGGGGG + Intergenic
915155199 1:153869914-153869936 TCCAGCTGGTCTTGAACTCCTGG - Intronic
915332758 1:155123801-155123823 CCCAACTGCTCAGCAACTGAGGG + Intergenic
915398571 1:155605590-155605612 TCAAGCTGGTCACGAACTCCAGG - Intergenic
915880935 1:159670738-159670760 TCCAGCTACTCAGGAGTTGAAGG - Intergenic
916611411 1:166395610-166395632 TCCAGGTGAAAAGGAACTGATGG - Intergenic
917939413 1:179903211-179903233 CCAGGCTGGTCATGAACTGAAGG - Intronic
918415202 1:184299005-184299027 CCCAGGTGGTCAGGAATAGAGGG + Intergenic
919244158 1:194955927-194955949 CCCAACTGGTTAGGAATTGAGGG - Intergenic
919777275 1:201202465-201202487 GCCAGTGGGCCAGGAACTGAGGG - Intronic
920077410 1:203347522-203347544 TACAGCTGCTCAAGAGCTGAGGG + Exonic
920122203 1:203667159-203667181 TCCAGCTGGTCTCGAACTCCTGG + Intronic
921011380 1:211145269-211145291 TCCAGATGGCAAGGAACTGAAGG - Intergenic
921079739 1:211729479-211729501 CCCACATGGCCAGGAACTGAGGG - Intergenic
922229215 1:223671182-223671204 TCAGGCTGGTCTGGAACTGCTGG - Intergenic
922537307 1:226390699-226390721 TCCAGCCAGTGAGGAGCTGAGGG + Intronic
922938900 1:229443948-229443970 TCCAGCTGGTCTTGAACTACTGG + Intronic
923110853 1:230888854-230888876 TGCAGCTGGAAAGGAAGTGAGGG - Intergenic
1064229493 10:13517541-13517563 CCCAGCTGGTCTTGAACTGCTGG - Intronic
1064321911 10:14313141-14313163 CCAAGCTGGTCAGGAACTCCTGG - Intronic
1064604823 10:17028023-17028045 TTCAGATGTTCAGGGACTGACGG + Intronic
1065730161 10:28703243-28703265 TCCAGCTGCTCAGGAGGTGGAGG - Intergenic
1065781010 10:29167842-29167864 CCCAGATGGTCAAGAACTGTGGG - Intergenic
1065836717 10:29665028-29665050 TCCAGCTGGTCTTGAACTCCTGG - Intronic
1066448553 10:35507010-35507032 GCTAGCTGGGCAGGCACTGAGGG + Intronic
1066567890 10:36739615-36739637 TCCAGCGGGACAGGATATGAAGG - Intergenic
1068985619 10:63105168-63105190 TCCAGCTACTCTGGAAGTGAAGG + Intergenic
1069079752 10:64076050-64076072 TGCAGCTGGTCTGAAACTCACGG + Intergenic
1069719216 10:70539224-70539246 TCCAGCTGGTCAGGAGCCACAGG - Exonic
1071332380 10:84572891-84572913 CCCAGTTTGTCTGGAACTGAAGG - Intergenic
1074719064 10:116248981-116249003 TTTAGCTGGTTAGGAACTGGGGG - Intronic
1075673265 10:124278644-124278666 TCCACATGGCAAGGAACTGAAGG - Intergenic
1075976479 10:126700539-126700561 TCCATGTGGCAAGGAACTGAGGG + Intergenic
1076131854 10:128019001-128019023 TCCAGTGGGTCAGGAGCCGAGGG + Intronic
1076203947 10:128580160-128580182 TGCTGCTGGTGAGGAATTGAAGG - Intergenic
1076623165 10:131806012-131806034 TCCTGTTGCTCAGGAACTGCTGG - Intergenic
1076723685 10:132403834-132403856 CCCAGCAGGGCAGGACCTGAGGG + Intronic
1076747275 10:132520592-132520614 TCCGGCTGCTCAGGACCTGCTGG + Intergenic
1077008087 11:368644-368666 TCCTGTGGGTCAGGAACTCAGGG - Intergenic
1078080308 11:8199614-8199636 TCCAAGTGCTCAGGAAGTGAGGG + Intergenic
1078645790 11:13140563-13140585 TCAGGCTGGGCAGGAAATGATGG - Intergenic
1078928836 11:15897841-15897863 GCAAGCTGGTAAAGAACTGAGGG + Intergenic
1080588857 11:33704079-33704101 AGCACCTGGTCAGGATCTGATGG - Intronic
1083372596 11:62193781-62193803 TCCTGCTGGTCTTGTACTGAGGG + Intergenic
1083384262 11:62296009-62296031 TCCTGCTGGTCTTGGACTGAGGG - Intergenic
1085929364 11:81062584-81062606 TCCAGCTGCTCATGAAAGGAAGG - Intergenic
1087416431 11:97862025-97862047 TCCAGCAAGGCAGGAACTTATGG + Intergenic
1088240238 11:107766555-107766577 TCCAGTTGGTCATGAACTCCCGG - Intergenic
1088928847 11:114328749-114328771 TCCAGCTGGTCTTGAACTCCTGG - Intergenic
1088984985 11:114897901-114897923 TCCAGCTAGTCAGGCTCTGAAGG - Intergenic
1089014724 11:115156663-115156685 TGCTGCTGGTCAGCAAATGAAGG - Intergenic
1089872085 11:121684316-121684338 TCCTTCAGGTCAGGACCTGAAGG + Intergenic
1090921320 11:131208381-131208403 TCCAAATGGTCAGGATGTGAAGG + Intergenic
1092281535 12:7101382-7101404 ACCAGCTACTCAGGGACTGAGGG - Intronic
1092866812 12:12769016-12769038 TCCAGCTGGTCTTGAACTCCTGG - Intronic
1093041215 12:14381438-14381460 TCAGGCTGGTCTGGAACTCATGG + Intronic
1094174457 12:27527065-27527087 GTCAGCTAGTCAGTAACTGAGGG - Intronic
1094469471 12:30790268-30790290 TCCATGTGGCAAGGAACTGAGGG + Intergenic
1094493525 12:30975902-30975924 TCCTGCTGCACAGGACCTGAAGG - Intronic
1096695907 12:53348156-53348178 TCCAGCTGGTCTTGAACTCCTGG + Intergenic
1096800159 12:54105277-54105299 TCCAGCTGGTCTTGAACTCCTGG - Intergenic
1096814457 12:54193103-54193125 TCAAGCTGGTCTTGAACTGCTGG + Intergenic
1097960996 12:65531834-65531856 TAGAGCTGGTCAGGAACAGCTGG - Intergenic
1099460557 12:82915982-82916004 TCAAGCTGGTCTGGAACTTCTGG - Intronic
1099716188 12:86296474-86296496 TCCAGTTGCACAGGAACTCATGG + Intronic
1100137244 12:91568452-91568474 TTCAGCTGGTCAGGAGATGAAGG + Intergenic
1100352212 12:93795309-93795331 TCCAGATGAGCAGGAACTTAGGG - Intronic
1101919402 12:108920034-108920056 GCCAGTTGGCAAGGAACTGAAGG + Intronic
1102243675 12:111341712-111341734 TCCTGCTGGCCAGGAACTTTTGG + Intronic
1104611520 12:130232573-130232595 TCCAGCTAGTAAGGAACATATGG + Intergenic
1105274425 13:18906330-18906352 TCCAGCTGGCCAGGAACTGCTGG - Intergenic
1105515975 13:21091047-21091069 CCCAGCTGGTCTGGAACTCCTGG + Intergenic
1106158636 13:27180780-27180802 CCCAGCTGGTCTGGAACTCCTGG - Intergenic
1106468899 13:30037489-30037511 TCCAGATTGTCAGGAAGGGAAGG - Intergenic
1107985629 13:45773855-45773877 TGCTGCTGCTCAGGAACTAATGG + Intergenic
1108802141 13:54111733-54111755 TCAAGCTGGTCTGGAACTCCTGG - Intergenic
1109229661 13:59741545-59741567 GCCAGCTGGTCATGAACTCCTGG - Intronic
1109784212 13:67153378-67153400 CCCAGCTGGTCTTGAACTCAGGG + Intronic
1110455605 13:75687082-75687104 TCCATCCTGTCAGGAAGTGAGGG + Intronic
1111079639 13:83286137-83286159 CCCAGCTGCTCAGGACCTGATGG - Intergenic
1115035742 14:28854345-28854367 TCCAGCTACTCAGGAGCTGGAGG + Intergenic
1115948302 14:38690306-38690328 TCCAGTTGCTCAGGACCTAAAGG + Intergenic
1115987295 14:39115241-39115263 GCCAGCTGGTCTGGAACTCCTGG + Intronic
1116597525 14:46869836-46869858 TCCACATGGTGAGGAATTGAGGG + Intronic
1116824132 14:49655409-49655431 TCCAGCTGGTCTTGAACTTCAGG + Intronic
1118101204 14:62605298-62605320 TCCAGTTGGTAAGGAGCTGTTGG - Intergenic
1118418636 14:65574158-65574180 TCCACTTGGAAAGGAACTGAGGG - Intronic
1118694465 14:68370919-68370941 CCCAGCTGCTCAGGAAGTGGAGG + Intronic
1119117046 14:72033442-72033464 CCCAGCTGGTCTGGAACTCCTGG + Intronic
1119310545 14:73642829-73642851 TCAAGCTGGTCTGGAACTCCCGG + Intergenic
1119417246 14:74480392-74480414 TCCAGCCAGACAGGACCTGAAGG - Intronic
1119901537 14:78264547-78264569 GCCAGCAGGGCAGAAACTGATGG + Intronic
1121348532 14:93154383-93154405 TCAGGCTGGTCTGGAACTCATGG - Intergenic
1121770074 14:96526543-96526565 TCCAGCTGGTCTCGAACTCCTGG + Intronic
1121887503 14:97557410-97557432 TCAGCCTGGGCAGGAACTGAGGG - Intergenic
1122554821 14:102572572-102572594 TCCTGCTGGTCTGGAACTCCTGG + Intergenic
1122805620 14:104255073-104255095 TCTCGGTGGGCAGGAACTGAGGG - Intergenic
1122855795 14:104559557-104559579 AGAAGCTGGTCAGGAACTGGAGG - Intronic
1122929548 14:104927066-104927088 CCCAGCTGCCCAGGCACTGAGGG + Intronic
1123538306 15:21261509-21261531 TCCAGCTGACCAGGAATTGCTGG + Intergenic
1125827938 15:42691832-42691854 TCCAGCTGGTCGTGAAATCAGGG - Exonic
1126603769 15:50455189-50455211 TCCAGTTGTTCAGGAGGTGAAGG - Intronic
1126876013 15:53042089-53042111 TCCAGCTGGTCTTGAACTCCTGG - Intergenic
1127632608 15:60840853-60840875 TCCAGCTGGTCAGGCTTCGATGG - Intronic
1128497090 15:68204844-68204866 TCCAACTGGTCAGGTTCTGGAGG + Intronic
1129233915 15:74212412-74212434 TCCAGCTGAGCAGGAGCTGGAGG - Intergenic
1130605551 15:85313238-85313260 TCTAGTTGGTTAAGAACTGAAGG - Intergenic
1131424659 15:92335633-92335655 TCCAGCTGGTCTCGAACTCCTGG + Intergenic
1132677209 16:1125767-1125789 TCCAGCTGGCCAGGCTCTGAGGG + Intergenic
1135198185 16:20411960-20411982 TCCAGTTGTTCATCAACTGAAGG + Intronic
1135220045 16:20606608-20606630 TCCAGTTGTTCATCAACTGAAGG - Intergenic
1136117123 16:28101514-28101536 CACAGCTGGTCAGGAACTCTGGG + Exonic
1136620089 16:31422898-31422920 CCCAGCTGGTCTGGAACTCCTGG + Intronic
1139021401 16:62754196-62754218 TCCACCTGATGAGGAGCTGATGG + Intergenic
1140087988 16:71813288-71813310 CCAAGCTGGTCTGGAACTCATGG + Intergenic
1140585744 16:76289778-76289800 TCAAGCTGGTCTTGAACTGCTGG + Intronic
1140921703 16:79544272-79544294 TCTAGTGTGTCAGGAACTGAAGG - Intergenic
1141465768 16:84204911-84204933 TCCAGCTGGTCCGCAAGTGCCGG + Intergenic
1143067021 17:4257830-4257852 TCCATCTGGTAAGGTACTGTCGG - Intronic
1143459765 17:7094769-7094791 TTCATCTGGGCAGGAACTGGTGG - Intergenic
1143572717 17:7770464-7770486 TCCAGCTGTTCATCATCTGATGG + Intronic
1144126052 17:12204016-12204038 CCCAGCTGGTCTTGAACTGCTGG + Intergenic
1144696860 17:17310332-17310354 CCCAGCTGGTCTTGAACTGCTGG - Intronic
1144838465 17:18171044-18171066 TCCAGCTGGTCAGGATGGGCTGG + Intronic
1145193340 17:20866921-20866943 TCCAGCTGGCCAGGAATTGCTGG + Intronic
1145298680 17:21614160-21614182 TCCAGCTGGCCAGGAATTGCTGG - Intergenic
1145351599 17:22089130-22089152 TCCAGCTGGCCAGGAATTGCTGG + Intergenic
1145403758 17:22568935-22568957 TCCAGCTGGCCAGGAATTGCTGG + Intergenic
1145723168 17:27090896-27090918 TCCAGCTGGCCAGGAATTGCTGG - Intergenic
1149668057 17:58380096-58380118 TCCACCAGGTGAGGAACTCAGGG + Intronic
1150025382 17:61668780-61668802 TCCAGCTGGTCTGGAACTACTGG + Intergenic
1150422825 17:65054518-65054540 CCCAGCTGGTCTGGAACTCCTGG + Intronic
1150519936 17:65855578-65855600 TCCAACAGGTCAGGGACTAAAGG + Intronic
1150558356 17:66274010-66274032 TCCAGCTGGTCTAGAACTCCTGG - Intergenic
1150679613 17:67274252-67274274 TCCAGCTGGTCTGAAACTCCTGG + Intergenic
1150786717 17:68169430-68169452 TCCAGCTGCACAGGAACTTACGG + Intergenic
1152063346 17:78095608-78095630 TCGTGCTGGTCACGAGCTGAAGG - Intronic
1153894607 18:9547101-9547123 TCATGCTGGTCATGACCTGAAGG - Exonic
1154466114 18:14643585-14643607 TCCAGCTGGCCAGGAACTGCTGG - Intergenic
1155007726 18:21742989-21743011 TCCGGCTGGTCTGGAACTCCTGG + Intronic
1155082947 18:22428779-22428801 TCCAGCTGGCCAGGCAGTGTGGG + Intergenic
1156128044 18:33931969-33931991 TCCAGATGGTAAGAAACTGCTGG - Intronic
1157250347 18:46089864-46089886 TCCAGTTGGTGAGGAGCTGTTGG - Exonic
1157562114 18:48655628-48655650 CCCAGCTGCTCAGTGACTGAGGG + Intronic
1158157311 18:54440511-54440533 GTCAGCTGGACAGTAACTGATGG + Intergenic
1158161724 18:54492370-54492392 TCCATCTGTTCATTAACTGAAGG - Intergenic
1158180954 18:54714388-54714410 CCCATCAGGTCAGGAACTGCTGG - Intergenic
1160020397 18:75176105-75176127 GCCAGCTGGTCACGAACTCCTGG + Intergenic
1160155978 18:76434058-76434080 TCCAGCTGGTCAGGAACTGACGG + Intronic
1160261635 18:77299593-77299615 CTCAGCTGGTCAGGAACTGTGGG + Intergenic
1160778186 19:866313-866335 CTCAAGTGGTCAGGAACTGATGG + Intergenic
1161144190 19:2667567-2667589 TCCAGCTGGTCTTGAACTCCTGG - Intronic
1161157636 19:2741181-2741203 TCCAGAGGGAAAGGAACTGAGGG + Intergenic
1162059875 19:8087968-8087990 GCCAGCTGGGTAGGGACTGAGGG + Intronic
1163421002 19:17213586-17213608 CCCAGCAGGACAGGAACAGATGG + Intronic
1165159075 19:33805389-33805411 ACTAGCTGGGCAGGAGCTGAGGG - Intronic
1165360406 19:35333112-35333134 CCCAGAGGGGCAGGAACTGAGGG - Intronic
1165526780 19:36362662-36362684 TCAAGCTGGTCTTGAACTTACGG - Intronic
1166040090 19:40197074-40197096 TCCAGCTGGTCCGCAAATGCAGG - Intronic
1166312085 19:41968778-41968800 TCCAGCAGGGCATGAAGTGAGGG - Exonic
1166903010 19:46080899-46080921 TCCACCTGGACAGGAAGTGATGG - Intergenic
1167083904 19:47296079-47296101 TCAAGCTGGTCTTGAACTGCTGG - Intronic
1167394839 19:49221626-49221648 TCAAGCTGGTCTGGAACTCCTGG + Intergenic
1167410539 19:49341321-49341343 ACCGCCTGGTCAGGGACTGAAGG - Exonic
1168467307 19:56613542-56613564 ACCAGATGGAAAGGAACTGAAGG - Intronic
925281372 2:2687561-2687583 CCCAGCTGATCAGGAGCTTATGG + Intergenic
926001200 2:9334256-9334278 GCCAGCTGGTCTGGAACTCCTGG + Intronic
926128850 2:10287864-10287886 GCCACCTGGCCAGGAACTGCGGG - Intergenic
926158127 2:10469362-10469384 TCCACCTGGTCAGGGTCTGAGGG + Intergenic
926648158 2:15312484-15312506 CCAAGCTGGTCTTGAACTGATGG + Intronic
927007107 2:18862109-18862131 TACACCTGGTCAGGAAATGTGGG + Intergenic
927409527 2:22808283-22808305 TCCATGTGGTAAGGAACTGTGGG + Intergenic
927479088 2:23436352-23436374 TCCAGCTTTTGAGAAACTGAAGG - Intronic
927525105 2:23732706-23732728 TCCAGCAGATCAGAAACTGGGGG - Intergenic
928563815 2:32521321-32521343 CCCAGGTGGTCTGGAACTCATGG - Intronic
928872321 2:35994888-35994910 CCCTGCTGGGAAGGAACTGAGGG - Intergenic
928874885 2:36026367-36026389 CCCAGCTACTCAGGAAGTGAAGG + Intergenic
928984319 2:37166234-37166256 TCCAGCTGGTCTTGAACTCCTGG + Intergenic
929418514 2:41767908-41767930 TCCACATGGGAAGGAACTGAGGG - Intergenic
930408854 2:50997716-50997738 CCCAGCTGGTCTGGAACTCTGGG + Intronic
930713887 2:54574589-54574611 TGCAGCTTATCAGCAACTGATGG - Intronic
932369706 2:71176931-71176953 CCCAGCAGATAAGGAACTGAGGG + Intergenic
935830252 2:106994660-106994682 TGCATTTGGACAGGAACTGATGG + Intergenic
935902327 2:107805988-107806010 TCCAGTTGGTTAGGAAGTAAAGG - Intergenic
936038871 2:109133963-109133985 TCCAGCTGGTCAGCTAGTGGAGG + Intronic
937106796 2:119323308-119323330 TACACCTGGTCAGGAAATGTGGG + Intronic
937426959 2:121807922-121807944 CCCGGCTGGTCTGGAACTCATGG + Intergenic
937992475 2:127672371-127672393 GCCAGCTGGGCAGGGAGTGAAGG - Intronic
939117241 2:138074545-138074567 TCCATAAGGTGAGGAACTGAAGG - Intergenic
939685051 2:145188901-145188923 CCCAGATGGTAAGGAGCTGAGGG + Intergenic
941153418 2:161943261-161943283 TCCAGCTGTTCCGGATCTGCTGG + Intronic
942661012 2:178265325-178265347 TCCAGCTACTTAGGAACTTAAGG - Intronic
942902511 2:181138885-181138907 TGCAGATGGTCAGGAATAGAGGG + Intergenic
943562423 2:189479742-189479764 TCCAGTAGGAAAGGAACTGAGGG - Intergenic
944660540 2:201917993-201918015 TCCAGCTGGTCTTGAACTCCTGG + Intergenic
944770818 2:202912502-202912524 TCCGGCGGGTCAGGAGGTGACGG - Intronic
945396116 2:209321093-209321115 TCCACATGGAAAGGAACTGAGGG - Intergenic
1169547937 20:6670047-6670069 TCGAGCTGTTGAGGAACTCATGG - Intergenic
1170103566 20:12728816-12728838 TCCAGGTGGCAAGGAGCTGAGGG - Intergenic
1170699947 20:18695006-18695028 TCATGCTGGTCATGACCTGAAGG - Intronic
1171062304 20:21977750-21977772 TCCAGAGGGTCCGGAACTGACGG - Intergenic
1171722443 20:28577776-28577798 TCCGGCTGGTCTGGAACTCCTGG + Intergenic
1171851946 20:30315103-30315125 TCCAGCTGGTCTTGAACTCCTGG - Intergenic
1173355132 20:42280112-42280134 TCCGGGTGGTCAGGAAGGGATGG + Intronic
1173705059 20:45103993-45104015 TAAACCTGGTCAGGGACTGAGGG - Intergenic
1174578202 20:51552593-51552615 TCCCACTGGGCAGGCACTGATGG + Intronic
1174895796 20:54448805-54448827 TCCAGCTGGTCTTGAACTCCTGG - Intergenic
1175583627 20:60120123-60120145 TCCAGCTGGAGATGACCTGATGG + Intergenic
1176808471 21:13515011-13515033 TCCAGCTGGCCAGGAACTGCTGG + Intergenic
1177147583 21:17423142-17423164 TCCATATGGTAAGGAAGTGAGGG + Intergenic
1179033793 21:37742770-37742792 TAAAGCAGGACAGGAACTGATGG - Intronic
1179084554 21:38206012-38206034 TCCAGCTGCTCTGGAGCTGCTGG - Intronic
1179124017 21:38575725-38575747 ACCAGCTGTTCAGAACCTGACGG + Exonic
1179945387 21:44670731-44670753 TACAGCTGCTCAGGACCTGGTGG - Intronic
1180295993 22:10936460-10936482 TCCGGCTGGTCTGGAACTCCTGG + Intergenic
1180412680 22:12629549-12629571 TCCAGCTAGTCTGGAACTCCTGG - Intergenic
1180655452 22:17416709-17416731 CCGAGCTGGTCTGGAACTGCTGG + Intronic
1180712793 22:17851083-17851105 TCCAGGTGGGCAGGTAATGAAGG - Intronic
1180730825 22:17980847-17980869 TGCAGTTGAGCAGGAACTGAGGG - Intronic
1180844458 22:18973614-18973636 TCCAGCTGGTGAGGACAGGACGG + Intergenic
1180942028 22:19665897-19665919 TCCAGCTGGTCTGGAGATAAGGG - Intergenic
1181057015 22:20265097-20265119 TCCAGCTGGTGAGGACAGGACGG - Intronic
1181095129 22:20499719-20499741 CCAAGCTGGTCAGGAACTCCTGG + Intronic
1181137094 22:20775697-20775719 TCCAGCTGGTCTTGAACTCCTGG + Intronic
1181310792 22:21943732-21943754 TCCCCCTGCCCAGGAACTGAAGG + Intronic
1181641210 22:24200008-24200030 TCAGGCTGGTCAGGAACTGCTGG + Intergenic
1182316575 22:29451426-29451448 TCCAGCTACTCAGGAAGTCAAGG + Intergenic
1182324282 22:29500314-29500336 CCAAGCTGGTCAGGAACTCCTGG - Intergenic
1182372549 22:29821783-29821805 TCCAGCTGGTCTTGAACTCCTGG - Intronic
1182561747 22:31165125-31165147 TCAAGCTGGTCTGGAACTCCCGG + Intronic
1184029733 22:41885103-41885125 TCCAGGTGGGCAGCACCTGATGG - Intronic
1184316750 22:43699280-43699302 CCCAGCAGGGCAGGAACTGAGGG - Intronic
949263048 3:2124550-2124572 TCCAGCTGGTCTTGAACTCCTGG - Intronic
951123172 3:18952148-18952170 TCAAGCTGGTGAGGAAAAGAAGG + Intergenic
951554376 3:23905947-23905969 TCCAGCTGGTCTTGAACTCCTGG - Intronic
952031550 3:29148638-29148660 TCAAGCTGGTCTGGAACTCCTGG + Intergenic
952746228 3:36783936-36783958 TCCAGTTGGTAATGATCTGAAGG + Intergenic
952962169 3:38599098-38599120 TCCAGCAGGACAGGAGCTGGGGG - Intronic
953736579 3:45499082-45499104 TCCAGCTGGTCTTGAACTCCTGG - Intronic
954052404 3:47991459-47991481 TCTGGCTGGTCTGGAACTCATGG - Intronic
954072773 3:48155085-48155107 TCAGGCTGGTCAAGAACTGCTGG + Intergenic
955143660 3:56294519-56294541 CCCATGTGGTAAGGAACTGAGGG - Intronic
955416853 3:58700269-58700291 TCCACATGGTGAGGAACTGAGGG - Intergenic
955749891 3:62177052-62177074 CCAAGCTGGTCAGGAACTGCTGG - Intronic
956834712 3:73087279-73087301 TCCAGCTGGTCTTGAACTCCTGG + Intergenic
956911003 3:73816892-73816914 TCCTGCTGGACAGGATATGAGGG + Intergenic
957638839 3:82822430-82822452 TCCAGCTGCTCAGGAAGCTAAGG - Intergenic
958534570 3:95382340-95382362 TGGAGATGGCCAGGAACTGAGGG - Intergenic
958843159 3:99233114-99233136 TCCAGCTGTTCAGGAAAAGAGGG - Intergenic
960092672 3:113657390-113657412 TGCTGCTGTTCAGCAACTGAAGG + Exonic
961249371 3:125486839-125486861 TCAGGCTGGTCTGGAACTGCTGG - Intronic
962448523 3:135491746-135491768 TCCACATGGCAAGGAACTGAGGG - Intergenic
964468921 3:157030838-157030860 TCCATGTGGCAAGGAACTGAGGG - Intronic
965087136 3:164113718-164113740 TGCAGCTGTTCAGGGAATGAGGG - Intergenic
966617694 3:181929739-181929761 TCCTGCTGTTCACGAACAGATGG + Intergenic
970493722 4:16604060-16604082 TCCAGCTGGTCTTGAACTCCTGG + Intronic
972454750 4:39242611-39242633 TCCAGCTGGTCTTGAACTCCTGG - Intronic
973911270 4:55583176-55583198 TCCAGCTGGTCTTGAACTCCTGG + Intronic
974492493 4:62585210-62585232 TCCAGCTGGTTTGGAACTCCTGG - Intergenic
975151551 4:71028380-71028402 CCAAGCTGGTCAGGAACTCCTGG - Intronic
977610162 4:99022466-99022488 TCCTACTGAGCAGGAACTGAGGG - Intronic
978308883 4:107363932-107363954 CCCAGCTGGTCTTGAACTCATGG - Intergenic
978575581 4:110186686-110186708 TCCAGCTAGTCAGGAAGCTAAGG + Intronic
982455832 4:155608620-155608642 TCCACCTGGCAAGGAACTGTGGG + Intergenic
983012786 4:162568947-162568969 TCCAGCTACTCAGGAACTACAGG - Intergenic
983517816 4:168675843-168675865 TCCAGCTGGTCTTGAACTTCTGG - Intronic
984670019 4:182472930-182472952 TCAGGCTGGTCTGGAACTGCTGG + Intronic
984730732 4:183065802-183065824 TCAAGCTGGTCTGGAACTCCTGG - Intergenic
986268860 5:6214178-6214200 TCCAGCTCATCATGAACTGCAGG - Intergenic
986646363 5:9920376-9920398 TCCAGCTGGTCTTGAACTCTTGG - Intergenic
987203683 5:15603047-15603069 TCCAGCTGGTCTTGAACTCCTGG + Intronic
987531442 5:19126237-19126259 TCCAAATGGTCAGGAAAGGAGGG - Intergenic
987677863 5:21098397-21098419 TCCATGTGATCAGGAAGTGAAGG + Intergenic
988519296 5:31931513-31931535 TGCAGCTGGGCAGGAGTTGAGGG + Intronic
989086982 5:37686092-37686114 CCCAGCTGGTCATGAACTCCTGG - Intronic
989087037 5:37686516-37686538 CCCAGCTGGTCATGAACTCCTGG - Intronic
991246110 5:64509942-64509964 CCCAGATGGTGAGGAACTAAAGG - Intronic
991431243 5:66549706-66549728 ACCAGATGGCAAGGAACTGAGGG + Intergenic
991481838 5:67089496-67089518 TCCAGCTGCTTAGGAGCAGAGGG + Intronic
991916701 5:71612789-71612811 TCCAGCTGGTCTTGAACTCCTGG + Intronic
993505381 5:88702582-88702604 TCCTGCTGTTCAGGCACTGCAGG + Intergenic
994079934 5:95697312-95697334 GCCACATGGTAAGGAACTGAGGG - Intronic
994174496 5:96696637-96696659 TCAAGCTGGTCATGAACTCCTGG - Intronic
996668336 5:126086849-126086871 TCCAGCAGATCAGCAGCTGAGGG + Intergenic
997122409 5:131189029-131189051 TCCAGCTACTCAGGAAGTAAGGG + Intronic
999403574 5:151286499-151286521 TCCAGCTGGTCTTGAACTCCTGG + Intronic
1000902446 5:166927022-166927044 TCCAGCCGCGCAGGAGCTGACGG + Intergenic
1001309425 5:170600256-170600278 TCCAGGTGGTGAGAAACTTAAGG - Intronic
1001519343 5:172379664-172379686 GCCAGCTGCTCAGGAAGTGGCGG - Intronic
1001755446 5:174165100-174165122 TCCAGCTTGCCAGGGACTGAGGG + Intronic
1004502500 6:16221644-16221666 CCCAGCTGGTCACGAACTGCTGG + Intergenic
1004783990 6:18945256-18945278 CCCGGCTGGTCTGGAACTGCTGG - Intergenic
1005403421 6:25459459-25459481 CCCAGCTGGTCATGAACTCCTGG + Intronic
1005520746 6:26598468-26598490 TCCTACTGAGCAGGAACTGAGGG + Exonic
1007302826 6:40881073-40881095 CCCAGCTGGTCTGGGACTGGGGG + Intergenic
1007600980 6:43081068-43081090 TCCAGCTGGACTGGAATGGAGGG - Intronic
1007615904 6:43179716-43179738 CCCAGCTACTCAGGAGCTGAAGG - Exonic
1007716255 6:43857853-43857875 TCCAGATGGGCAAGCACTGAAGG + Intergenic
1009346885 6:62624445-62624467 TCCAGCTGGTCTTGAACTCCTGG + Intergenic
1010115204 6:72298057-72298079 TCCAGTTTGTCAGGGACTGAGGG + Intronic
1010327301 6:74579465-74579487 GACAGCTGGTAAGCAACTGAAGG - Intergenic
1010672978 6:78708802-78708824 TCAGTCTAGTCAGGAACTGAGGG - Intergenic
1012666405 6:101976485-101976507 CCCAGCTGGTCTCGAACTGCTGG - Intronic
1013548119 6:111180332-111180354 TCAAGCTGGTCTTGAACTGCTGG - Intronic
1017104396 6:150874322-150874344 GCCAGCTGGGCCGGAACAGATGG - Intronic
1018869563 6:167770619-167770641 TCGAGCTGGGCAGGAACAGGAGG - Intergenic
1018895431 6:168013290-168013312 TCCAGCTGGTAGGGCAGTGATGG + Intronic
1019461883 7:1163821-1163843 TCCAGCTGCTCAGGATGTTAAGG + Intergenic
1019738658 7:2662372-2662394 TCCAGCAGGGCAGGTGCTGAGGG - Exonic
1020104661 7:5416780-5416802 TCCAGCTGGTCTCGAACTCCTGG - Intronic
1021424056 7:20478910-20478932 TCAAGCAGGTAAGGAAATGAAGG + Intergenic
1022662850 7:32382494-32382516 TCCAGATGGTCAGCATCTGGAGG - Intergenic
1024652846 7:51421630-51421652 TCCAGCTGGTCTCGAACTCCTGG + Intergenic
1025275970 7:57581278-57581300 TCCAGCTGGCCAGGAATTGCTGG - Intergenic
1027270701 7:76516956-76516978 CCCAGCTGGTCTGGAACTCCTGG - Intergenic
1029678582 7:102091542-102091564 CCCAGCTGGTCTTGAACTGCTGG + Intronic
1030309844 7:108058144-108058166 TCCAGCTGTTCAGGGACAGGTGG + Intronic
1031585986 7:123532954-123532976 TCCGGCGGGTCAGGAGGTGACGG + Intronic
1032201203 7:129824510-129824532 TCAAGCTGGTCTGGAACTCCTGG + Intergenic
1033147866 7:138886484-138886506 CCCAGCTGATCTGGAACTGCAGG + Intronic
1035239115 7:157518444-157518466 TCCAGATGGTCAGAGACTGCTGG + Intergenic
1037690188 8:21175239-21175261 TCAAGCTGGTCATGAACTCCTGG + Intergenic
1038506862 8:28092166-28092188 TGCAGCTGTTTAGGAACAGAAGG + Intronic
1038600606 8:28938655-28938677 TCCAGCTGGTCTTGAACTCCTGG + Intronic
1038662242 8:29507315-29507337 TCCAGCTGGTCTTGAACTCCTGG + Intergenic
1039550175 8:38437669-38437691 TACAGCTGGCCAGGAACAGAAGG + Intronic
1040387859 8:46925749-46925771 TCCGTGTGGCCAGGAACTGAGGG + Intergenic
1040461932 8:47657818-47657840 TCAGGCTGGTCTGGAACTCATGG - Intronic
1040507968 8:48068787-48068809 CCAAGCTGGTCTGGAACTGCTGG + Intergenic
1042930142 8:74005239-74005261 CCCATGTGGTAAGGAACTGACGG - Intronic
1043040599 8:75258007-75258029 GCCAGATGGCCAGGAACTTAGGG + Intergenic
1043407909 8:79957498-79957520 TCAAGCTGGTCTGGAACTTATGG - Intronic
1043855058 8:85255471-85255493 TCAAGCTGGTCTGGAACTCCTGG + Intronic
1045350047 8:101330133-101330155 TCCACCTGGAGAGGCACTGAGGG - Intergenic
1045372060 8:101534339-101534361 AACAGCCGGTGAGGAACTGAGGG - Intronic
1046064804 8:109183466-109183488 GCCAGGTGGTCAGGCACTTAAGG - Intergenic
1046081817 8:109378791-109378813 ACTAGTTGGTTAGGAACTGAAGG + Intronic
1047324632 8:123824618-123824640 TCCAGATGGACATGAACTGGAGG - Intergenic
1050558527 9:6809787-6809809 TCCAGCTGGTCTCGAACTCCTGG - Intronic
1052831862 9:33222205-33222227 GCCAGGTGTTCAGGAAATGATGG - Intronic
1053605597 9:39655414-39655436 TCCAGTTGGTGAGGAGCTGTTGG - Intergenic
1053789733 9:41678357-41678379 TCCAGCTGGTCTTGAACTCCTGG - Intergenic
1053863517 9:42412044-42412066 TCCAGTTGGTGAGGAGCTGTTGG - Intergenic
1054155411 9:61636396-61636418 TCCAGCTGGTCTTGAACTCCTGG + Intergenic
1054178071 9:61890047-61890069 TCCAGCTGGTCTTGAACTCCTGG - Intergenic
1054247946 9:62687001-62687023 TCCAGTTGGTGAGGAGCTGTTGG + Intergenic
1054475197 9:65567507-65567529 TCCAGCTGGTCTTGAACTCCTGG + Intergenic
1054562060 9:66721526-66721548 TCCAGTTGGTGAGGAGCTGTTGG + Intergenic
1054659458 9:67690777-67690799 TCCAGCTGGTCTTGAACTCCTGG + Intergenic
1054806386 9:69399774-69399796 TCAGGCTGGTCTGGAACTCATGG + Intergenic
1055553770 9:77455233-77455255 GCCACATGGCCAGGAACTGAGGG - Intronic
1055648127 9:78379967-78379989 TCAGGCTGGTCACGAACTGCTGG - Intergenic
1057379155 9:94553550-94553572 TCCAGCTGGCCAGGAATTGCTGG + Intergenic
1058456401 9:105141812-105141834 TTCACATGGTGAGGAACTGAGGG + Intergenic
1059479798 9:114580294-114580316 TCCAGCTAATCAGGAAGTTAAGG + Intergenic
1060733682 9:126052989-126053011 TCCAGCTGGGCAGTCCCTGAAGG + Intergenic
1060915606 9:127387934-127387956 CCCAGCTGGTCTTGAACTGCTGG - Intronic
1061328016 9:129875684-129875706 CCCAGCTGGGCAGGAAAAGAGGG + Intronic
1061329934 9:129885945-129885967 TCCAGCGGGTCAGGAAATACCGG - Intergenic
1061453186 9:130679868-130679890 CCCAGCTGGTCTGGAACTCCTGG + Intronic
1185524503 X:766488-766510 TCCAGCTGCTCAGGCAGTTAAGG + Intergenic
1186178486 X:6949959-6949981 TCCACATGGCCAGGAATTGAGGG - Intergenic
1186293252 X:8121892-8121914 TCCAGCTGTGCAGGAGCCGATGG - Intergenic
1186542917 X:10419266-10419288 CCCACATGGCCAGGAACTGAGGG + Intergenic
1187521115 X:20014924-20014946 TCAAGCTGGTCTGGAACTTCTGG + Intronic
1187859229 X:23665882-23665904 TCCAGCTGGAAAGGAACTATGGG - Intronic
1188310220 X:28607881-28607903 TCCATCTGTACAGAAACTGAGGG + Intronic
1188901026 X:35733570-35733592 TCAAGCTGATCAGGGGCTGAAGG - Intergenic
1189612448 X:42751879-42751901 CCCACATGGTAAGGAACTGAGGG - Intergenic
1192135533 X:68595709-68595731 TCAAGCTGGTCTGGAACTCCTGG + Intergenic
1195405414 X:104507779-104507801 TCCACATGGTGAGGAACTAATGG - Intergenic
1196416562 X:115477947-115477969 CCAAGCTGGTCTGGAACTGCTGG - Intergenic
1197752826 X:129977220-129977242 CCCAGCTGGTCTTGAACTGCTGG - Intergenic
1197763532 X:130044329-130044351 TCCAGCTGGGCAGAAAATGAAGG + Intronic
1199664560 X:150086370-150086392 TCCAGCTCCCCAGGAAGTGATGG - Intergenic
1199980164 X:152916449-152916471 TCCTGCTTGGCAGCAACTGAGGG - Intronic