ID: 1160156257

View in Genome Browser
Species Human (GRCh38)
Location 18:76436131-76436153
Sequence GCCCCCCTTAGTATCCAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 56}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160156257_1160156263 30 Left 1160156257 18:76436131-76436153 CCTGTCTGGATACTAAGGGGGGC 0: 1
1: 0
2: 0
3: 0
4: 56
Right 1160156263 18:76436184-76436206 TGCAAGCTCCTGTTTAATAGAGG 0: 1
1: 0
2: 0
3: 8
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160156257 Original CRISPR GCCCCCCTTAGTATCCAGAC AGG (reversed) Intronic
918478093 1:184947626-184947648 ACCCCCCTTCCTATACAGACAGG + Intronic
923901110 1:238327205-238327227 GCCCCCCTCACTTCCCAGACGGG + Intergenic
1080910691 11:36594861-36594883 GCGCTCCTAAGCATCCAGACAGG - Exonic
1081150918 11:39630647-39630669 ACCTCTCTTTGTATCCAGACTGG + Intergenic
1091407158 12:216223-216245 GACCCACTTGGTATTCAGACTGG + Intergenic
1091407217 12:216603-216625 GACCCACTTGGTATTCAGACTGG + Intergenic
1098585159 12:72145555-72145577 GCCCTCATTAGAATCCAGCCAGG - Intronic
1098999871 12:77167024-77167046 CCAACCCTTGGTATCCAGACTGG - Intergenic
1107337067 13:39366442-39366464 GCACCCATGAGTATCCAGTCCGG + Intronic
1108323485 13:49308165-49308187 GCCCCCCTCACCAGCCAGACTGG - Intergenic
1114221046 14:20697068-20697090 GCACCCATTGGTATCCACACTGG + Intronic
1115128478 14:30024985-30025007 TCATCCCTTAGTATCCAGAAAGG + Intronic
1132980557 16:2736838-2736860 GGCCCCCATAGTGTCCAGGCTGG + Intergenic
1135967274 16:27046473-27046495 GCCTCCCTTGGTCTCCTGACTGG + Intergenic
1138037734 16:53625375-53625397 GCCCCCCCCAGTTCCCAGACGGG - Intronic
1138349362 16:56338335-56338357 GCCCCACTCAGCATCAAGACTGG - Intronic
1146408552 17:32561658-32561680 GCCTCCCTCTGTCTCCAGACTGG - Intronic
1147362728 17:39941836-39941858 TCCCTCCTTAGTTTGCAGACCGG - Intronic
1147927507 17:43954618-43954640 GGCCACCTGTGTATCCAGACTGG + Intronic
1151544842 17:74786401-74786423 GGCCCCCTCAGTACCCAGAAGGG - Intronic
1152890664 17:82879965-82879987 GCCCCCCTGAGCCTCCAGAAAGG - Intronic
1160156257 18:76436131-76436153 GCCCCCCTTAGTATCCAGACAGG - Intronic
1161233588 19:3187398-3187420 GGCCCCCTTAGTTCCCAGCCCGG + Intronic
1164016738 19:21260851-21260873 GCGCTCCTCAGTACCCAGACAGG + Intronic
1167453346 19:49585050-49585072 GCCCCCCTTAGCAACAAGGCTGG - Intronic
927511670 2:23647903-23647925 TCCCCCCTCAGTATCCAAGCCGG + Intronic
946846331 2:223861991-223862013 GACCAACTTTGTATCCAGACAGG + Intronic
1172910855 20:38407743-38407765 GCGCCCCCTACCATCCAGACGGG - Intergenic
1174320641 20:49739183-49739205 GCCACCCTGAGACTCCAGACTGG - Intergenic
1182754640 22:32668851-32668873 ACTCCCCTTAGGATCCAGAGTGG + Intronic
1184605483 22:45571790-45571812 AGCCTCCCTAGTATCCAGACTGG + Intronic
949556492 3:5157833-5157855 GGCTGCCTTTGTATCCAGACTGG + Intronic
952833828 3:37587914-37587936 GCCCACGTTAGCATCCAGAGTGG + Intronic
954405035 3:50340891-50340913 GCCTCCCCCAGGATCCAGACTGG + Intronic
958406880 3:93763454-93763476 GCCCCCCTCAGCTCCCAGACGGG + Intergenic
958742861 3:98095845-98095867 GACCCCCTGTGTATCCTGACTGG - Intergenic
959054179 3:101551768-101551790 GCGCCCCTCAGTTCCCAGACGGG - Intergenic
965136936 3:164784590-164784612 GCGCTCCTCAGTACCCAGACGGG - Intergenic
973021290 4:45207938-45207960 GCGCCCCTCAGTTCCCAGACGGG - Intergenic
982349008 4:154394345-154394367 GCCCCCCTCAGGAGTCAGACAGG + Intronic
986276385 5:6278821-6278843 GCCCTCCTCAGCATCCAGTCAGG - Intergenic
986323017 5:6649181-6649203 GACCCCCTGTGTATCCACACTGG - Intronic
993700309 5:91111470-91111492 TTCCCACTTAGTATCCAGAAGGG + Intronic
997962257 5:138331527-138331549 GTCCCCCTTAGGGTCCAGTCGGG - Intronic
1002585829 5:180247310-180247332 GCCCCCCTTAGAACACAGTCTGG + Intronic
1013016983 6:106168854-106168876 GCCCACCTGACTTTCCAGACAGG + Intergenic
1014199929 6:118597815-118597837 GCCCCACACGGTATCCAGACTGG - Intronic
1020414109 7:7926021-7926043 GCCCCCCTCAGAAGCCAGGCAGG + Intronic
1035144089 7:156795661-156795683 TCCCACCTTAGTCTCCAGAGGGG + Intronic
1045659021 8:104416935-104416957 GCCCCCTCTAGAATCCAGAAGGG + Intronic
1047674911 8:127190622-127190644 GACACCCTTAGTATCCTGATTGG + Intergenic
1050725073 9:8640039-8640061 TCCCACCTTAGCATCCAGAGTGG + Intronic
1060217335 9:121746233-121746255 GCCCCCATTACCATCCAGGCTGG - Intronic
1189506007 X:41612785-41612807 GCGCCCCTCAGCTTCCAGACGGG - Intronic
1195643996 X:107207806-107207828 TCCCACCTCAGCATCCAGACAGG - Intronic
1195728460 X:107940977-107940999 CCCCCCCTAACTTTCCAGACAGG - Intergenic
1202057257 Y:20848110-20848132 GACCCACTGTGTATCCAGACTGG - Intergenic