ID: 1160156838

View in Genome Browser
Species Human (GRCh38)
Location 18:76441226-76441248
Sequence CCAGGTGAGCAAGTGTACCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 146}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160156838_1160156843 -9 Left 1160156838 18:76441226-76441248 CCTGGGTACACTTGCTCACCTGG 0: 1
1: 0
2: 0
3: 12
4: 146
Right 1160156843 18:76441240-76441262 CTCACCTGGTGCAGGTTCAGGGG 0: 1
1: 0
2: 0
3: 15
4: 168
1160156838_1160156850 27 Left 1160156838 18:76441226-76441248 CCTGGGTACACTTGCTCACCTGG 0: 1
1: 0
2: 0
3: 12
4: 146
Right 1160156850 18:76441276-76441298 ACTGTCTTCGGCAGCCTCGTCGG 0: 1
1: 0
2: 0
3: 8
4: 46
1160156838_1160156842 -10 Left 1160156838 18:76441226-76441248 CCTGGGTACACTTGCTCACCTGG 0: 1
1: 0
2: 0
3: 12
4: 146
Right 1160156842 18:76441239-76441261 GCTCACCTGGTGCAGGTTCAGGG 0: 1
1: 0
2: 0
3: 13
4: 163
1160156838_1160156845 15 Left 1160156838 18:76441226-76441248 CCTGGGTACACTTGCTCACCTGG 0: 1
1: 0
2: 0
3: 12
4: 146
Right 1160156845 18:76441264-76441286 GCCCTCCTCACCACTGTCTTCGG 0: 1
1: 0
2: 2
3: 17
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160156838 Original CRISPR CCAGGTGAGCAAGTGTACCC AGG (reversed) Exonic
900844336 1:5084314-5084336 CCAGGTGTTCAAGTCTAGCCTGG - Intergenic
902603495 1:17555954-17555976 CCAGGTGAGCCAGCGTCCCTGGG - Intronic
905968375 1:42118545-42118567 CCAGAGGAAAAAGTGTACCCAGG + Intergenic
908522179 1:64955118-64955140 CAATTTGAGCAAGTGTACACAGG + Intronic
916519480 1:165551034-165551056 CCAGGTGAGCAAGTGCAGAGTGG + Intronic
923571985 1:235124395-235124417 CCAGATGAGAAAATGTACCAAGG + Intronic
924293758 1:242565066-242565088 ACAGTTGAGCAGTTGTACCCCGG - Intergenic
1062987301 10:1780454-1780476 CCAGGTGGGCAGGTGTTCCTTGG + Intergenic
1065720517 10:28624539-28624561 CCAGGTGACCTAGTGAAACCAGG - Intergenic
1065957754 10:30707959-30707981 CCAGGTGTTCAAGACTACCCTGG + Intergenic
1069924756 10:71841097-71841119 CCAAGTGAGCAAGTGGAGGCAGG + Intronic
1071567646 10:86680038-86680060 CCAGGTGAGGAAGTTGCCCCTGG - Intronic
1074203584 10:111260866-111260888 TCAGGTGAGGAAGAGGACCCCGG - Intergenic
1074673162 10:115818866-115818888 CAAGGTGAGCAAGAGAACCACGG + Intronic
1075749887 10:124758317-124758339 CCAGGCCAGCAAGTGTCACCAGG - Intronic
1075895596 10:125991931-125991953 CCAGGTGAGCAGGGGCACCGAGG - Intronic
1076122395 10:127946607-127946629 ACAGATGAGCAAGTGTGCACAGG - Intronic
1076473345 10:130735518-130735540 CAAGGTCAGCAGGTGTACCATGG + Intergenic
1076473349 10:130735541-130735563 CAAGGAGAGCAGGTGTACCATGG + Intergenic
1077185668 11:1234386-1234408 CCAGGTGGGTAAGTGTCTCCAGG - Intronic
1080898796 11:36467883-36467905 CCAGGTGACCCAGTGAACACAGG + Intergenic
1083425260 11:62581087-62581109 CCAGGTGAGTGAGTGTCCCAGGG - Exonic
1086224687 11:84493666-84493688 CCTGGTGAGCAAGATTACACAGG + Intronic
1091333642 11:134750768-134750790 CAAGGTGAGCCTGTGTACTCAGG + Intergenic
1092762453 12:11822032-11822054 CCAGTTGAGAAAGTCTTCCCTGG + Intronic
1094832094 12:34304934-34304956 CCAGGGAAGCAAGTGTCCCCGGG - Intergenic
1095083050 12:38029786-38029808 CCAGGTGAGCATGGGTACAGAGG + Intergenic
1096673569 12:53214445-53214467 CCAGCTGGGCAAGTATACCACGG - Exonic
1098189721 12:67935395-67935417 CCAGCTTAGCAAGTGTCCCAAGG + Intergenic
1101318000 12:103647071-103647093 CCACATGAGAAAGTGTACACAGG - Intronic
1101800245 12:108015730-108015752 CCACGTTACCAAGTGTTCCCAGG - Intergenic
1102248539 12:111370064-111370086 CCAGGTAAGCAGGTGCAGCCAGG + Intergenic
1103522905 12:121548355-121548377 TCAGGTGAGCAGGTGGCCCCTGG + Intronic
1107199194 13:37693346-37693368 CCTGGTGAGAAAGTGTACAGTGG + Intronic
1113092248 13:106628138-106628160 CCAGGTGAGCATGTAGGCCCAGG + Intergenic
1113908901 13:113832615-113832637 CCAGGTGAGGAGGTGTCCACAGG - Exonic
1119546569 14:75476406-75476428 ACAGGTGAGCAACTTTACACAGG + Intergenic
1119665584 14:76482756-76482778 CCAGGTGAGCATGTGGGACCAGG + Exonic
1119736233 14:76984608-76984630 CCAGTTGAGCAAAGGGACCCTGG - Intergenic
1129699567 15:77759925-77759947 CCAGGTGAGCAGTAGTGCCCTGG - Intronic
1132771625 16:1566859-1566881 CCAGGTGAGCAGGTGCCGCCAGG - Intronic
1138416949 16:56876990-56877012 CCAGCTGAGCAGGGGTGCCCAGG + Intronic
1139289081 16:65840880-65840902 CCAGGGGAGCAAGTGTAAGCAGG - Intergenic
1139847594 16:69931887-69931909 CCAGGTGAGCTTGAGTGCCCCGG + Exonic
1142474756 17:182153-182175 ACAGGTGATCAAGGGCACCCAGG + Intergenic
1143732823 17:8890631-8890653 GCAGGAGACTAAGTGTACCCTGG + Intronic
1146952171 17:36914337-36914359 CCAGGAGAGCAAGACTAGCCTGG + Intergenic
1147925184 17:43941542-43941564 CCACTGGAGCCAGTGTACCCAGG - Exonic
1149849158 17:60025255-60025277 ACAGGTGATCAAGGGCACCCAGG - Intergenic
1149861010 17:60121269-60121291 ACAGGTGATCAAGGGCACCCAGG + Intergenic
1150486797 17:65549779-65549801 CCAGGTGAGCAACTGGACCTGGG - Intronic
1151172507 17:72259114-72259136 CCAGGAGTTCAAGTCTACCCTGG - Intergenic
1152307815 17:79531361-79531383 CCAGGCGAGCAGGTGGGCCCAGG + Intergenic
1152351869 17:79788622-79788644 CCAGATCTGCAAGTGTTCCCTGG - Intergenic
1155457556 18:26035022-26035044 CCAGGGCAGCAAGGTTACCCAGG - Exonic
1156842357 18:41624340-41624362 ACAGATGAGGAAGTGTTCCCCGG + Intergenic
1157200361 18:45654194-45654216 CCAGTTGAGGAAGGGTACCATGG - Intronic
1158461889 18:57653733-57653755 CCAGGTGTTCAAGTCTAGCCTGG - Intronic
1158966122 18:62623796-62623818 CCAGGTGTGCCCATGTACCCAGG + Intergenic
1160156838 18:76441226-76441248 CCAGGTGAGCAAGTGTACCCAGG - Exonic
1160435117 18:78845670-78845692 CCAGGTGGGCAAAGGGACCCTGG - Intergenic
1161840692 19:6678512-6678534 CCTGGTTTGCAAGTGCACCCGGG + Intronic
1165255222 19:34573592-34573614 CCATGTGTGCATGTGCACCCAGG + Intergenic
1165267113 19:34669505-34669527 CCATGTGTGCATGTGCACCCAGG - Intronic
1165919585 19:39287060-39287082 CCAGGTGTTCAAGAGTAGCCTGG + Intergenic
1166303577 19:41925513-41925535 ACAGGTGAGCAAGTGTACAAGGG + Intronic
1167298890 19:48667919-48667941 ACACGTGTGCAAGTGTACCCTGG - Intronic
1168705771 19:58469538-58469560 CCAGGGCAGCAACTGTGCCCAGG - Intronic
925406982 2:3612420-3612442 CCAGGTGAGAAGGCGGACCCTGG + Intronic
931211339 2:60199069-60199091 CCAGGTGATCAAGTGATTCCTGG - Intergenic
933306912 2:80612172-80612194 CAAGGTGAGCAAGTTTAACTTGG + Intronic
933615468 2:84478641-84478663 CCCTGTGTGCAAGAGTACCCCGG + Intergenic
933666330 2:84968102-84968124 CCATTTGAGAAAGTGTACCTGGG - Intergenic
936815680 2:116457233-116457255 CCTGGTGAGAATGTGTATCCTGG + Intergenic
937097325 2:119243848-119243870 CCAGGTGAGGGAGTGGATCCAGG - Intronic
937400385 2:121577863-121577885 CCAGGAGTTCAAGAGTACCCTGG + Intronic
948771102 2:240251604-240251626 CTTGGTGAGCAAGTCTTCCCTGG + Intergenic
1169090572 20:2859153-2859175 CCAGGTGTGGTAGTGCACCCTGG + Intronic
1170034256 20:11973374-11973396 CCATGTGAGCAAGGATACTCAGG + Intergenic
1170192670 20:13659507-13659529 CCAAGTGAGGAAGTGCTCCCAGG + Intergenic
1170973240 20:21136640-21136662 CCAGGTGTTCAAGTCTAGCCTGG - Intronic
1174894450 20:54434155-54434177 CCAGGCGAGCCAGGGGACCCTGG - Intergenic
1175824867 20:61931334-61931356 CCAGGTCAGGAAGCGTCCCCCGG + Intronic
1178703416 21:34853159-34853181 CCAGGTCCCCAAGTGGACCCTGG + Intronic
1178763083 21:35422649-35422671 CCAGGAGAGCCAGGGTACCTAGG + Intronic
1179107467 21:38415682-38415704 CCAGTTGTGCAAGTGTTCCCGGG + Intronic
1180729138 22:17968345-17968367 ACAGGTGAGCAGGTGTTCACAGG + Intronic
1184230761 22:43157241-43157263 CCCCATGAGCACGTGTACCCTGG + Intronic
1184795795 22:46731705-46731727 GCTGGTGAGCACGTGTGCCCCGG + Intronic
1185081603 22:48712516-48712538 CCATGTGAGCCTGTGTGCCCAGG - Intronic
953688241 3:45094907-45094929 GCAGGTGAGCAAGGGTGACCAGG - Intronic
960026731 3:113019207-113019229 CCGGGTGAGCAAGGGTTCCCAGG + Intronic
961975981 3:131026000-131026022 CCAGGTGAGGAAGCGTAGCTGGG - Intronic
962053777 3:131847207-131847229 ACATATGAGCAAGTGGACCCAGG - Intronic
971196579 4:24475865-24475887 CCAGGTGAGCAAATCTATCAAGG - Intergenic
975503981 4:75117801-75117823 CCAGGGTGGCAAGTGTCCCCAGG - Intergenic
976972928 4:91129839-91129861 CCAGGTGGCAAAATGTACCCAGG + Intronic
977830960 4:101592110-101592132 CCATGTGTGAAAGTGTAGCCAGG - Intronic
979666054 4:123312049-123312071 CCAGATGAGCATGTGTACCATGG - Intronic
980241048 4:130176259-130176281 CCTGGTGAGCAGGTTTACCGTGG + Intergenic
983616442 4:169710901-169710923 CCAGGAGTTCAAGTCTACCCTGG - Intronic
985905267 5:2830291-2830313 GCAGGTGAGCCAGGGTCCCCAGG + Intergenic
986052596 5:4104301-4104323 ACTGGTGAGCAAATGTTCCCAGG + Intergenic
990199461 5:53354850-53354872 CCAGGTTAGAAACTCTACCCAGG - Intergenic
996591602 5:125154239-125154261 CCTGGTGAGCATATGTAGCCTGG - Intergenic
997388392 5:133493582-133493604 CCAGGACAGCAAGTGTACTTTGG - Intronic
999636092 5:153624238-153624260 CCATCTGAGCAATTGTCCCCAGG + Intronic
1002068175 5:176662885-176662907 CCAGGTGTGCAGGTGCAGCCAGG - Intergenic
1002291199 5:178202172-178202194 CCAGGTGGGCAAGTGCCCTCTGG - Intergenic
1002933967 6:1656003-1656025 AGAGGTGAGCAACTGGACCCAGG + Intronic
1003052491 6:2792658-2792680 CCAGGTGAGCAATAGCACCTGGG - Intergenic
1003573258 6:7269777-7269799 GCAGGTGAGGCACTGTACCCAGG + Intronic
1004871518 6:19909193-19909215 CCAGATGAACATATGTACCCGGG + Intergenic
1005459650 6:26056149-26056171 CCTGGTGAGCAAGGGCACTCTGG - Exonic
1005470307 6:26156648-26156670 CCTGGTGAGCAAGGGCACCCTGG + Exonic
1005648793 6:27867241-27867263 CTTGGTGAGCAAGGGCACCCTGG - Exonic
1007100211 6:39240784-39240806 CCAGGGGAGGAAGTCTTCCCTGG + Intergenic
1007720298 6:43881189-43881211 GAAGGTGAGAGAGTGTACCCAGG + Intergenic
1008826670 6:55702770-55702792 CCAAGTGAGAAAGTGTATCAAGG - Intergenic
1011786694 6:90854428-90854450 CCAGGAGAGCAGGTGGCCCCAGG + Intergenic
1015826486 6:137317929-137317951 CCAGGTGAGAAAGGGTTACCAGG - Intergenic
1016908401 6:149173583-149173605 CTAGGGGAGAAAGTGTTCCCTGG - Intergenic
1020012407 7:4813622-4813644 CCAGGACAGCAAATGTCCCCAGG + Intronic
1021743023 7:23706808-23706830 CCAAGTGACCAGGTGTACCAGGG - Intergenic
1021925264 7:25528434-25528456 CTGGGTGAGCAATTGTAGCCTGG - Intergenic
1022412153 7:30147584-30147606 CCAGGTCAGCAAATGCCCCCAGG + Intronic
1023469068 7:40493670-40493692 CCAGCTTAGCAAGTGAACCTAGG - Intronic
1026233254 7:68504020-68504042 CCTGGTAAGCAAGTGCACTCAGG + Intergenic
1027187656 7:75981603-75981625 CCAGGTGAGCAAGTGCCCGCAGG + Exonic
1029408513 7:100392568-100392590 CCATGAGAGCCAGTGTTCCCTGG - Intronic
1033615386 7:143009461-143009483 CCAGCTGAGCTAGTGTCCCCCGG + Intergenic
1033980673 7:147161339-147161361 CCAGCTGAACAACAGTACCCAGG - Intronic
1036594220 8:10197690-10197712 CCAGGTGGGCATGTGTAGGCAGG - Intronic
1036670114 8:10777947-10777969 CCGTGTGAGCAAGTGTGTCCTGG - Intronic
1037123882 8:15321344-15321366 CCAGGGTAGCAACTGTACACTGG - Intergenic
1037311691 8:17562929-17562951 CCAGGAGTTCAAGTGTAGCCTGG + Intronic
1039710917 8:40055294-40055316 TTAGATGAACAAGTGTACCCTGG + Intergenic
1047255870 8:123213037-123213059 CCAGGTGAGCACTTATACCTGGG + Intergenic
1047354563 8:124108148-124108170 CCAGGAGCTCAAGTCTACCCTGG + Intronic
1047885948 8:129250323-129250345 CCAGGTGAGACAATGTACCATGG + Intergenic
1048564615 8:135582146-135582168 CAAGGTGAGGAAGCGTACGCGGG - Intronic
1049879900 8:145054682-145054704 CCAGGTGAGGGACTGGACCCAGG - Exonic
1049985473 9:946847-946869 CCAGGTCTGCAAGTTTACACTGG + Intronic
1051333072 9:16042883-16042905 GTAGGTGAGCAAGTGCACCAAGG + Intronic
1051750565 9:20337167-20337189 CCAGCTGAGCAATTCCACCCTGG + Intergenic
1053098809 9:35352099-35352121 ACAGGTGAGCACCTGTTCCCTGG + Intronic
1057226182 9:93294487-93294509 CCTGCTGAGCAAATGTGCCCAGG - Intronic
1057422452 9:94923291-94923313 CCAGGTGTGCAAATGGCCCCAGG - Intronic
1059225457 9:112668828-112668850 ACAGCTGAGCAAGAGGACCCTGG - Intronic
1062348892 9:136129228-136129250 CCAGGAGAGCAGGTCTACACAGG + Intergenic
1186564885 X:10651835-10651857 CCAGGAGAGCAAGACTAACCTGG - Intronic
1187859516 X:23667733-23667755 GCGGGTGGACAAGTGTACCCGGG + Exonic
1192235861 X:69295565-69295587 CCCAGAGAGCAAGAGTACCCAGG + Intergenic
1193607637 X:83588278-83588300 CCCAGTGAGCAAGTGTAACAGGG + Intergenic
1195746187 X:108121186-108121208 ACAGGGGAGTAAGTGAACCCAGG + Intronic
1197326881 X:125105466-125105488 CCAGGTGAGAACATGTACCCAGG - Intergenic
1197555710 X:127950071-127950093 CGAGGAGAGCAAGTGAACCAAGG + Intergenic
1198051232 X:132955544-132955566 CCAGGGTACCAAGTGCACCCGGG + Intronic
1198307466 X:135397351-135397373 CCAGGTAATCAAGTGGACCTGGG - Intergenic