ID: 1160157015

View in Genome Browser
Species Human (GRCh38)
Location 18:76441941-76441963
Sequence CACGCGCGCCCCGGCCGAGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 125}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160157015_1160157024 13 Left 1160157015 18:76441941-76441963 CCTCCTCGGCCGGGGCGCGCGTG 0: 1
1: 0
2: 1
3: 11
4: 125
Right 1160157024 18:76441977-76441999 CTCTGCGGTGGATGGCATTGTGG 0: 1
1: 0
2: 1
3: 7
4: 107
1160157015_1160157021 1 Left 1160157015 18:76441941-76441963 CCTCCTCGGCCGGGGCGCGCGTG 0: 1
1: 0
2: 1
3: 11
4: 125
Right 1160157021 18:76441965-76441987 GGCTGGCCTCGACTCTGCGGTGG 0: 1
1: 0
2: 0
3: 8
4: 109
1160157015_1160157022 5 Left 1160157015 18:76441941-76441963 CCTCCTCGGCCGGGGCGCGCGTG 0: 1
1: 0
2: 1
3: 11
4: 125
Right 1160157022 18:76441969-76441991 GGCCTCGACTCTGCGGTGGATGG 0: 1
1: 0
2: 0
3: 1
4: 78
1160157015_1160157025 14 Left 1160157015 18:76441941-76441963 CCTCCTCGGCCGGGGCGCGCGTG 0: 1
1: 0
2: 1
3: 11
4: 125
Right 1160157025 18:76441978-76442000 TCTGCGGTGGATGGCATTGTGGG 0: 1
1: 0
2: 1
3: 5
4: 89
1160157015_1160157020 -2 Left 1160157015 18:76441941-76441963 CCTCCTCGGCCGGGGCGCGCGTG 0: 1
1: 0
2: 1
3: 11
4: 125
Right 1160157020 18:76441962-76441984 TGCGGCTGGCCTCGACTCTGCGG 0: 1
1: 0
2: 0
3: 5
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160157015 Original CRISPR CACGCGCGCCCCGGCCGAGG AGG (reversed) Exonic
900180429 1:1308750-1308772 CACGTGGGCCCGGGCGGAGGCGG + Intronic
902350029 1:15847648-15847670 CGCGCGCGCCCGCGGCGAGGGGG + Intergenic
920027198 1:203007556-203007578 GACGCCTGCTCCGGCCGAGGTGG + Exonic
920504711 1:206507754-206507776 CTCGCGCGCCCCGGGCGCAGTGG - Exonic
1063395705 10:5685183-5685205 CCCGGGCGCCCAGGCCGAGGAGG - Intronic
1066464234 10:35639512-35639534 CGCGGGCGCCACGGCCGCGGGGG - Exonic
1070570783 10:77638175-77638197 CAGGGGCGCCCGGGCGGAGGGGG - Intronic
1075048619 10:119165667-119165689 CACGCGCGGCCTGGCGGCGGCGG - Exonic
1080418652 11:32091649-32091671 CCGCCGCGCCCCGGCCGGGGTGG + Intronic
1080606633 11:33869625-33869647 CGGGCGCGCCGCGGCCGAGGCGG + Intronic
1081528278 11:43942077-43942099 CGCGCGCGCGCCTGCGGAGGGGG + Intronic
1084129122 11:67119598-67119620 AACGCGGGCCCCGGCCCCGGGGG - Intronic
1084212284 11:67629804-67629826 CACGAGCACCGCGGCCGACGCGG + Exonic
1096178674 12:49539115-49539137 CACGCGAGCCGCTGCCGCGGCGG + Intergenic
1097981751 12:65742554-65742576 CGCGCGTGGCCCGGCCGCGGCGG - Intergenic
1099014132 12:77324962-77324984 GAGGCGCGGCCCGGCGGAGGAGG + Intergenic
1100618407 12:96249374-96249396 GACGCGCGCCACTGCGGAGGGGG + Intronic
1103091934 12:118103882-118103904 CCCGAGCGCCCTGGCCGGGGAGG + Exonic
1103700998 12:122848712-122848734 CACGCACTCCCCACCCGAGGCGG - Intronic
1114069994 14:19098621-19098643 CACCTGGGCCCCGGTCGAGGCGG - Intergenic
1114092268 14:19301381-19301403 CACCTGGGCCCCGGTCGAGGCGG + Intergenic
1115235593 14:31206929-31206951 CACCCGGGGCCCGGCCGAGCCGG + Intronic
1116835817 14:49768262-49768284 CAGGCGTGCCCCGGCGGCGGCGG + Exonic
1117336419 14:54760369-54760391 CCCGCTGGCCCCGGCCGAGGGGG - Exonic
1122635527 14:103127940-103127962 CACGAGCGCCCAGTCTGAGGAGG + Intronic
1122788664 14:104175390-104175412 CAGGCCAGCCCCGCCCGAGGGGG + Exonic
1122922994 14:104887601-104887623 CACGGGCCTCCCGGCTGAGGCGG + Exonic
1122942043 14:104985848-104985870 CCCGCGCGGCCCCGCCGAGGCGG + Exonic
1124014354 15:25863166-25863188 CACTCGCGGCCCGGGCGCGGCGG + Exonic
1124439273 15:29675005-29675027 CAGGCGCGCCCAGGCCCCGGCGG - Intergenic
1124999350 15:34754681-34754703 CAAGCGCGTCCCGACCGATGGGG + Exonic
1127083991 15:55408032-55408054 CACTCGCGCACGGCCCGAGGAGG + Intronic
1129102544 15:73279634-73279656 CACGCGGGCCCCGGGCGTGGTGG - Intronic
1132105356 15:99059120-99059142 CGCGTGCGCGCCGGCCGCGGCGG + Intergenic
1132365152 15:101251650-101251672 CACGCCCGCCCCCGCCGCCGCGG + Exonic
1132550514 16:552122-552144 CACGGGCGCGCTGGCCGAGCTGG - Exonic
1132747660 16:1443691-1443713 CACTCTCGCCCCGGCCAGGGTGG - Exonic
1133305376 16:4804981-4805003 CACTGGCCCCCCGGACGAGGTGG - Exonic
1137618067 16:49858397-49858419 CTCGCGCTCCCCAGCCGCGGGGG - Intergenic
1139890622 16:70251384-70251406 CGCGCTCGCCCTGGCCGACGCGG - Exonic
1141456491 16:84145531-84145553 CACGGGAGCGCAGGCCGAGGGGG + Exonic
1141828583 16:86497400-86497422 CGCGCGGGGCTCGGCCGAGGTGG + Intergenic
1143150869 17:4807136-4807158 AGCCCACGCCCCGGCCGAGGCGG - Exonic
1144695834 17:17303438-17303460 CACGCGCGCCCCAGCGTTGGGGG + Exonic
1150239943 17:63622918-63622940 CTCGCGCGCCGCGGCCCGGGCGG + Intronic
1151453324 17:74212422-74212444 CACCCGCGTCCCTGCCGCGGTGG + Intergenic
1152598297 17:81248982-81249004 CACGTGGCCCACGGCCGAGGTGG - Intronic
1152758819 17:82098015-82098037 CACGCGCGCCCCGAGAGCGGAGG + Intronic
1153489207 18:5630301-5630323 CACCCGCGCCCCTGCCCACGGGG + Intronic
1154202504 18:12308818-12308840 CACGCGGGTCCCGGCCGGGCAGG - Intronic
1158427428 18:57352608-57352630 CCCGCGCGCCCCTGCCTACGGGG + Exonic
1159586805 18:70289443-70289465 CCGGCGCGCCGCGGCCGAAGAGG - Intronic
1160028743 18:75240658-75240680 CACGGGCGCCCCCGCTGGGGAGG - Intronic
1160157015 18:76441941-76441963 CACGCGCGCCCCGGCCGAGGAGG - Exonic
1160909002 19:1466249-1466271 CACGCGGGCGTCGGCGGAGGTGG - Exonic
1160986147 19:1839859-1839881 CCCGTGCACCACGGCCGAGGAGG - Intronic
1161076942 19:2290400-2290422 CACGCGCGCCCGGCCCGCGCTGG + Exonic
1161172518 19:2820086-2820108 GCCGCGCGCGCCGGCCCAGGTGG - Exonic
1161264780 19:3359285-3359307 CGCGCGCGCCGCGGCGAAGGTGG + Intergenic
1162524142 19:11197642-11197664 CCCGGGCGCCCCGGCCGCGGTGG + Intronic
1163012243 19:14433442-14433464 CGCGTGCGCCCCGGGCGTGGCGG - Intronic
1163260320 19:16185717-16185739 CAAGCGGACCCCGGCCCAGGCGG + Exonic
1166139613 19:40799142-40799164 CACGTGCCCACCGGGCGAGGCGG + Intronic
1168692682 19:58386416-58386438 CGCGGGCTCCCCGGCCGTGGAGG + Intronic
925375698 2:3383401-3383423 CACCCCCGCCCCGCCCGAGACGG + Intronic
925609387 2:5691538-5691560 CCCGCGCGCCCCGCCCCGGGCGG - Intergenic
928606424 2:32947853-32947875 CTCGCGCGCACCGCCCGCGGAGG + Intronic
931429431 2:62196782-62196804 CCCGCGCGCCCCGGATGAGGAGG - Intronic
936433229 2:112482125-112482147 CACGCCCGCCCCCGCCGGCGCGG - Intergenic
937208625 2:120252995-120253017 CCCGCGGGCCCCGGGCGGGGTGG + Intronic
938451424 2:131424971-131424993 GACGCGCGCCCAGGCGGCGGGGG - Intergenic
938496707 2:131801688-131801710 CTCGGGCCCCCCGGCGGAGGAGG - Intergenic
942241108 2:173964674-173964696 CACCCGCCCCCCGGCGGCGGCGG + Intronic
948140769 2:235670462-235670484 CGGCAGCGCCCCGGCCGAGGAGG + Intronic
949004284 2:241636818-241636840 CCCCCGCGCCCCGGCCGCCGAGG + Intronic
1172118049 20:32583508-32583530 CTCTCGCGCTCCGGCCGGGGAGG + Intronic
1172447621 20:35001418-35001440 CTTGCCCGCCCAGGCCGAGGAGG + Exonic
1172702959 20:36863747-36863769 CGCGCGCCCCCGAGCCGAGGCGG - Intergenic
1174611706 20:51802488-51802510 CATGCGCGTTCCGGCCGAAGGGG - Exonic
1174648531 20:52105317-52105339 CATGCGCGTTCCGGCCGAAGGGG - Intronic
1175215807 20:57391305-57391327 CCCGCGCGCCCGGGGCGGGGCGG + Intergenic
1176068927 20:63216039-63216061 CGCGCGGGCCCCTGGCGAGGCGG + Exonic
1176549582 21:8215285-8215307 GGCGCGCTCGCCGGCCGAGGTGG + Intergenic
1176557473 21:8259514-8259536 GGCGCGCTCGCCGGCCGAGGTGG + Intergenic
1176568507 21:8398319-8398341 GGCGCGCTCGCCGGCCGAGGTGG + Intergenic
1176576418 21:8442548-8442570 GGCGCGCTCGCCGGCCGAGGTGG + Intergenic
1176715188 21:10343762-10343784 CCCGTGCGCCCCGGCCAAGCGGG - Intergenic
1178334694 21:31732377-31732399 CACGCGCGCTCCGCTCGACGCGG + Intergenic
1180008073 21:45032520-45032542 CACGTGGGGCCAGGCCGAGGGGG + Intergenic
1180488462 22:15821185-15821207 CACCTGGGCCCCGGTCGAGGCGG - Intergenic
1181082962 22:20426181-20426203 CACGCCAGCCTCCGCCGAGGAGG - Exonic
1184101461 22:42343642-42343664 CCCGCGCGCCCCGGCCGGCCCGG + Intergenic
1184347813 22:43924143-43924165 CCCCCGCTCCCCGGCCTAGGGGG - Intronic
1184465934 22:44668874-44668896 CACGCGCGACCCTGCGGAAGGGG + Intronic
1203254468 22_KI270733v1_random:131606-131628 GGCGCGCTCGCCGGCCGAGGTGG + Intergenic
1203262524 22_KI270733v1_random:176685-176707 GGCGCGCTCGCCGGCCGAGGTGG + Intergenic
954613047 3:51956268-51956290 GACCCGCGCGCCGGCCGTGGGGG - Exonic
954779070 3:53046017-53046039 CACCCGCGCTCCGGCGGAGGCGG + Exonic
955997057 3:64688168-64688190 CCCGCACGGGCCGGCCGAGGAGG - Intergenic
960939183 3:122922467-122922489 CACGCGCGCCCCGGCCACCAGGG + Intronic
961408929 3:126704410-126704432 CACGCCCGCCCCGGCCCAGGCGG - Intronic
963213952 3:142724290-142724312 CGCCGGCGCCCCGGCCGAGCCGG - Exonic
963939526 3:151085707-151085729 CTCGCGCTCCCGGGCCGTGGGGG + Intronic
966611001 3:181867972-181867994 CACCGGCGCCCGGCCCGAGGTGG - Intergenic
971279975 4:25234505-25234527 CCCGCGCGCGCTGGCCGAGGTGG + Intronic
976184381 4:82430150-82430172 CACGGGCGCGCGGGCCAAGGGGG + Exonic
976226587 4:82799021-82799043 CACCCGCCCCCGGGCGGAGGCGG - Intergenic
977693951 4:99946821-99946843 CTCGGACGCCCCGGCCCAGGAGG - Intergenic
990323258 5:54649506-54649528 AATGGGCGCCCAGGCCGAGGAGG + Intergenic
998583756 5:143404798-143404820 GACGCGGGCCCTGGCCGGGGTGG - Intronic
1002696794 5:181097712-181097734 CACCAGCGCCCCGGCAGAGAAGG + Intergenic
1002697828 5:181101661-181101683 CACCAGCGCCCCGGCAGAGAAGG - Intergenic
1003176793 6:3758034-3758056 AATGGGCGCCCAGGCCGAGGAGG - Intergenic
1006314030 6:33279811-33279833 CCCACGAGCCCTGGCCGAGGTGG - Exonic
1006642750 6:35497208-35497230 CAGGCGCGCGCCAGCCGGGGTGG - Intergenic
1007739653 6:44002831-44002853 CGCGCGCGCCCCGTCGGCGGCGG - Exonic
1015994778 6:138987352-138987374 GACTCGCGCCGCGGCCAAGGGGG - Intronic
1017662422 6:156687445-156687467 CCCCCACGCCCCGGCCGCGGCGG + Intergenic
1019406566 7:887140-887162 GACGGACGCCCTGGCCGAGGCGG - Intronic
1020099976 7:5389130-5389152 CCCGCGCGCCCGGGGCGAGGAGG - Exonic
1021491240 7:21221492-21221514 CACTCGGGCCCGGGCAGAGGCGG + Intergenic
1026765106 7:73155204-73155226 CGCCCGCGCCCCGTCCGCGGCGG - Intergenic
1027041579 7:74964959-74964981 CGCCCGCGCCCCGTCCGCGGCGG - Exonic
1027082063 7:75237410-75237432 CGCCCGCGCCCCGTCCGCGGCGG + Intergenic
1029672780 7:102045435-102045457 CCCGCGCGCCCCCTCCGATGTGG + Intronic
1034513680 7:151556796-151556818 CGCGTGCGCCCCGGCTGCGGCGG + Exonic
1034781937 7:153888490-153888512 CAGGCGCGCCCAGGCCGCGCGGG - Intronic
1039921426 8:41896698-41896720 CAAGCGAGCTCCGGCCGCGGCGG - Exonic
1049762751 8:144338381-144338403 CCCGCGCGGCGCGGCCGAGGGGG - Intergenic
1055611693 9:78031339-78031361 GACGCGCGCCCGGGCGGCGGGGG - Exonic
1060979821 9:127785682-127785704 CCCGCGCAGCCCGGCGGAGGCGG + Intronic
1061663501 9:132146741-132146763 CACGCGCCGCACGGCCGAGAGGG - Intergenic
1061975713 9:134067356-134067378 GCCGCGCGCCGCGGCCGGGGCGG - Intronic
1062358768 9:136177713-136177735 CACACGAGCCCTGGCCCAGGAGG - Intergenic
1203470869 Un_GL000220v1:114750-114772 GGCGCGCTCGCCGGCCGAGGTGG + Intergenic
1203478690 Un_GL000220v1:158722-158744 GGCGCGCTCGCCGGCCGAGGTGG + Intergenic
1188003494 X:25002568-25002590 CGCGCGCGCCCTGGAGGAGGGGG - Intergenic
1200100691 X:153688102-153688124 TCCGCGGGCCCCGGCCGGGGCGG + Exonic